ID: 1067993571

View in Genome Browser
Species Human (GRCh38)
Location 10:51243360-51243382
Sequence CTGGCTTCACAGCTATTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067993571_1067993575 5 Left 1067993571 10:51243360-51243382 CCCTGGAATAGCTGTGAAGCCAG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 1067993575 10:51243388-51243410 TCAGCAGAAGGCTCTTGCCCTGG No data
1067993571_1067993578 17 Left 1067993571 10:51243360-51243382 CCCTGGAATAGCTGTGAAGCCAG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 1067993578 10:51243400-51243422 TCTTGCCCTGGTCAGGGTGTAGG No data
1067993571_1067993576 10 Left 1067993571 10:51243360-51243382 CCCTGGAATAGCTGTGAAGCCAG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 1067993576 10:51243393-51243415 AGAAGGCTCTTGCCCTGGTCAGG No data
1067993571_1067993577 11 Left 1067993571 10:51243360-51243382 CCCTGGAATAGCTGTGAAGCCAG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 1067993577 10:51243394-51243416 GAAGGCTCTTGCCCTGGTCAGGG No data
1067993571_1067993573 -7 Left 1067993571 10:51243360-51243382 CCCTGGAATAGCTGTGAAGCCAG 0: 1
1: 0
2: 0
3: 24
4: 278
Right 1067993573 10:51243376-51243398 AAGCCAGAGCAGTCAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067993571 Original CRISPR CTGGCTTCACAGCTATTCCA GGG (reversed) Intronic
901208732 1:7512529-7512551 GTGGCTTCAAGTCTATTCCAGGG + Intronic
901763731 1:11487205-11487227 GTGGCTTCTCAGCTTTTCCTGGG - Intronic
902989678 1:20177940-20177962 AGGGCTTCACAGGTATTACATGG + Intergenic
903030721 1:20462422-20462444 CTGGGGTCTCAGCTCTTCCAAGG + Intergenic
904031424 1:27535864-27535886 CTGGATTCACAGCTCTGCTAGGG + Intronic
904549532 1:31304145-31304167 CTGCATTCAGAGCTATTGCAAGG + Intronic
906306292 1:44721921-44721943 CTGGCTTCCCAGCTATTGACTGG + Intronic
907282654 1:53361218-53361240 CTGGCGTCACCGCTAGACCAAGG + Intergenic
907829801 1:58053917-58053939 CTGTCTTCTCACCTAATCCATGG + Intronic
911239054 1:95445239-95445261 TTGGCTTCACAGGAATTTCAAGG + Intergenic
912226288 1:107738005-107738027 ATGGCTGCACAGTTATTCCATGG - Intronic
912311319 1:108624021-108624043 CTTGCTTCACAGCTTTTACGTGG + Intronic
913374640 1:118137201-118137223 CTGGCTTCTCTGCAACTCCAGGG + Intronic
916428469 1:164704329-164704351 CTGGTTGCACAGCTTTCCCAGGG + Intronic
916554658 1:165883818-165883840 ATGGCTTTGCAGATATTCCAGGG + Intronic
921681014 1:218031008-218031030 CTTGTTTCAGAGCTACTCCAAGG - Intergenic
921719264 1:218452400-218452422 CTTGCTTGACAGCTATTACCTGG + Intergenic
923863441 1:237915586-237915608 CTGGCGTCACCGCTAGACCAAGG - Intergenic
923864039 1:237919666-237919688 CTGGCGTCACAGCTAGACCAAGG + Intergenic
1065058815 10:21875800-21875822 CTGTAATCCCAGCTATTCCAGGG + Intronic
1065240522 10:23699226-23699248 CTGACTTCACAGCTCTGCCTAGG - Intronic
1066663691 10:37761219-37761241 CTGGCTCAACATTTATTCCAGGG - Intergenic
1067993571 10:51243360-51243382 CTGGCTTCACAGCTATTCCAGGG - Intronic
1068218770 10:54016529-54016551 ATGGCTGCATAGTTATTCCATGG - Intronic
1068433332 10:56960850-56960872 ATGGCTGCATAGCAATTCCATGG - Intergenic
1069381316 10:67845455-67845477 CTGTCATCACAGCTACTCGAGGG + Intergenic
1069595058 10:69665035-69665057 GTGCCTTCACAGCTAGGCCAGGG + Intergenic
1069613762 10:69793043-69793065 CTGCCTTCACAGCTACTGCTGGG + Intergenic
1071810735 10:89178264-89178286 CCAGCTTCACAGCTATACCCTGG + Intergenic
1073117079 10:101097291-101097313 CTGTCTTCACATCTGTTCCAAGG + Intronic
1073141397 10:101250651-101250673 CTGTGTTCCCAGCTATTCCGGGG - Intergenic
1074698494 10:116072440-116072462 CTGGCTTGACTGATATGCCACGG + Intronic
1076782284 10:132730999-132731021 CTGGCTGGACAGCAAGTCCACGG - Intronic
1076862288 10:133144065-133144087 CTGGCATCACCGCTAGACCAAGG - Intergenic
1076894753 10:133304901-133304923 CTGGCATCACCGCTAGACCAAGG - Intronic
1076896273 10:133314005-133314027 CTGGCGTCACCGCTAGACCAAGG - Intronic
1076940867 10:133607116-133607138 CTGGCTTCACATCTGCTCAATGG + Intergenic
1077006809 11:362056-362078 CTGGCATCACCGCTAGACCAAGG + Intergenic
1077050755 11:565694-565716 CTGCATTCAAAGCTGTTCCATGG + Intergenic
1077298045 11:1835146-1835168 CTGGCACCACAGCTATACCTGGG + Exonic
1077388369 11:2286558-2286580 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1078478957 11:11659566-11659588 CTAGTTTCACAGGTATGCCATGG + Intergenic
1080548062 11:33341595-33341617 CTGCCTGCAGAGGTATTCCATGG - Exonic
1080728243 11:34918312-34918334 CTGGCATCCCAGCTACTCCAGGG + Intronic
1081435938 11:43027513-43027535 CTGGCTTCACCTCTATTTTAAGG + Intergenic
1081716489 11:45254202-45254224 CTGCCTGCACAGCTTCTCCAGGG + Intronic
1083349388 11:62016607-62016629 CTGGCATCACCGCTAGACCAAGG - Intergenic
1084346088 11:68549912-68549934 CTGTCTCCACAGCTATTCACAGG - Intronic
1085106583 11:73848942-73848964 CTGTAGTCCCAGCTATTCCAGGG - Intronic
1086894997 11:92301708-92301730 TTTGTTTCACAGTTATTCCAGGG + Intergenic
1086982773 11:93216915-93216937 CCTGCTACACAGCTGTTCCAAGG + Intergenic
1087316497 11:96609418-96609440 ATGGCTGCATAGTTATTCCATGG + Intergenic
1088724403 11:112621400-112621422 CTGGCCTCAGAGCTAATCCAGGG - Intergenic
1089638610 11:119832466-119832488 CTGGGTTCCCAGCCTTTCCAGGG - Intergenic
1089760149 11:120717201-120717223 CTGGGGTCACAGCCATTGCAAGG + Intronic
1090519167 11:127460349-127460371 CTGGCTTCACAGTTGCTTCAAGG - Intergenic
1091086774 11:132728362-132728384 ATGCCTTCACAGTGATTCCAGGG - Intronic
1091681270 12:2528815-2528837 CAAGCTTCACAGCTCTTCCTGGG + Intronic
1092444131 12:8537996-8538018 CTGGCGTCACCGCTAGACCAAGG - Intronic
1092448986 12:8584664-8584686 CTGGCGTCACCGCTAGACCAAGG - Intergenic
1093247245 12:16754676-16754698 CTGGTTTCACAGCTAATCAATGG + Intergenic
1096660945 12:53123654-53123676 CTGGCTTCCCTCCCATTCCAGGG - Intronic
1096831585 12:54318665-54318687 CTGTATTCCCAGCTACTCCAGGG - Intronic
1097090602 12:56501396-56501418 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1099048553 12:77754815-77754837 CTGGCAACACATCTATCCCAAGG - Intergenic
1100247472 12:92775770-92775792 TTGGCATGAAAGCTATTCCAGGG + Exonic
1101390376 12:104294347-104294369 CTGGCATCACCGCTAGACCAAGG + Intronic
1101573068 12:105972992-105973014 CTTGCTTAACAGCGATTCTAGGG - Intergenic
1101899813 12:108783253-108783275 GTGTGTTCACATCTATTCCAAGG - Exonic
1102180191 12:110906858-110906880 CTGTCTTCACATCTGTTCAAGGG + Intronic
1102215023 12:111154803-111154825 CTGGCTTCCCTGCTTTTTCATGG - Intronic
1103179434 12:118896789-118896811 ATGGCTGCATAGTTATTCCATGG - Intergenic
1103341072 12:120221463-120221485 CTGGCATCACAGCAAGGCCAGGG + Intronic
1104685294 12:130780863-130780885 ATGGCATCACAGCCATTCCACGG - Intergenic
1105019999 12:132809553-132809575 CTGGCTTCACCGCTAGACCAAGG + Intronic
1105043060 12:132977080-132977102 CTGGCTTCACCGCTAGACCCAGG - Intergenic
1105876173 13:24555227-24555249 CTGGCATCACCGCTAGACCAAGG + Intergenic
1110601635 13:77381255-77381277 CTGTATTCCCAGCTACTCCAGGG + Intergenic
1110617779 13:77560313-77560335 CTGTCGTCCCAGCTACTCCAGGG + Intronic
1110941365 13:81354115-81354137 GTGGATTCACAGAGATTCCAGGG - Intergenic
1112252672 13:97797724-97797746 TGGGCTCCACAGCTAGTCCAGGG + Intergenic
1112493332 13:99885995-99886017 CTGGCCTCACAGCAGTTCCCAGG - Intronic
1113856819 13:113451056-113451078 CTGGCGTCACAGCTAGACCAAGG + Intronic
1114658074 14:24328109-24328131 CTGGCGTCACCGCTAGACCAAGG - Intronic
1115162500 14:30411698-30411720 CTGGCTGGACAGCTCTTTCAAGG - Intergenic
1121956524 14:98218422-98218444 CTTGCTTCACAGCAAAGCCAGGG + Intergenic
1125760234 15:42091462-42091484 CTGGCGTCACCGCTAGACCAAGG - Intronic
1125928697 15:43584402-43584424 CTGGCCTCATGCCTATTCCACGG + Exonic
1125941863 15:43684237-43684259 CTGGCCTCATGCCTATTCCACGG + Intergenic
1127963518 15:63907540-63907562 CTGGCATCCCAGCTACTCCAGGG - Exonic
1128924669 15:71644042-71644064 GTGGCTTTCAAGCTATTCCAAGG - Intronic
1131341638 15:91608171-91608193 ATGGCTGCATAGTTATTCCATGG - Intergenic
1132966864 16:2660955-2660977 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1132968000 16:2670209-2670231 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1133010370 16:2907225-2907247 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1133189803 16:4125244-4125266 ATGGCTTCCCAGCTTCTCCAGGG + Intergenic
1136136855 16:28261505-28261527 CTGTAGTCCCAGCTATTCCAGGG + Intergenic
1136319150 16:29471302-29471324 CTGGCGTCACCGCTAGACCAAGG - Intergenic
1136433721 16:30210646-30210668 CTGGCGTCACCGCTAGACCAAGG - Intergenic
1137587834 16:49674740-49674762 CTGCCTTCCCATCTGTTCCAAGG - Intronic
1137824153 16:51475216-51475238 CTGTAGTCTCAGCTATTCCAGGG - Intergenic
1142384261 16:89752764-89752786 CTGGCATCACCGCTAGACCAAGG - Intronic
1143172415 17:4937958-4937980 CTGCCTTCACACCTTTCCCAGGG + Intronic
1143278645 17:5733391-5733413 CTAGCTGCACAGGTATTACATGG + Intergenic
1143464428 17:7126573-7126595 CTGGCATCACCGCTAGACCAAGG - Intergenic
1143730845 17:8881880-8881902 CTGGCTACACTGCATTTCCAGGG - Exonic
1147346754 17:39802667-39802689 CTGTATTCCCAGCTATTCCCAGG - Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1147642940 17:42016105-42016127 CTGGCTTCTCTGATATCCCAGGG + Intronic
1150845896 17:68657651-68657673 CTGGCTTCTCAGCTACTCATGGG - Intergenic
1150915479 17:69432452-69432474 ATGGCTGCATAGTTATTCCATGG - Intronic
1151962870 17:77416469-77416491 CTGGCTTCACTGCTGCTTCAGGG - Intronic
1152718124 17:81909592-81909614 CTGTCTCCACAGCTATGACATGG - Exonic
1156842764 18:41628905-41628927 CTGTAGTCCCAGCTATTCCAGGG - Intergenic
1162613102 19:11771710-11771732 CTGGCGTCACTGCTAGACCAAGG - Intronic
1162729915 19:12712214-12712236 CTGGCGTCACCGCTAGACCAAGG - Intronic
1163456324 19:17407918-17407940 CTGGCGTCACCGCTAGACCAAGG + Intronic
1163471386 19:17499206-17499228 CTGGCGTCACCGCTAGACCAAGG + Intronic
1163479409 19:17546027-17546049 CTGGCGTCACCGCTAGACCAAGG + Intronic
1164083540 19:21880940-21880962 CTGGCATCACCGCTAGACCAAGG + Intergenic
1164084699 19:21890210-21890232 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1165123495 19:33578550-33578572 CTGTCTGCACAGATATTCCAGGG + Intergenic
1166911703 19:46163688-46163710 CTGGCTTCATAGCTCTGGCAGGG + Intergenic
1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG + Exonic
1167826102 19:51974741-51974763 CTGCCTTCACAGTCCTTCCACGG - Intronic
1167970335 19:53185295-53185317 CTGGCGTCACCGCTAGACCAAGG + Intronic
1168131539 19:54323055-54323077 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1168215169 19:54919831-54919853 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1168444037 19:56396315-56396337 CTGGCATCACCGCTAGACCAAGG + Intergenic
1168603367 19:57738529-57738551 CTGGCATCACCGCTAGACCAAGG - Intronic
1168613778 19:57821465-57821487 CTGGCTTCAGAGATTCTCCAGGG - Intronic
1168617765 19:57852170-57852192 CTGGCTTCAGAGATTCTCCAGGG - Intronic
925783220 2:7403028-7403050 CTGGCCACACAGCTGTTCCCAGG - Intergenic
925907554 2:8548229-8548251 CTGTCTTCACAGCAATTCACAGG + Intergenic
926161097 2:10489984-10490006 GAGGGTTCACAGCTCTTCCAGGG + Intergenic
928560596 2:32480762-32480784 CTGTAATCCCAGCTATTCCAGGG - Intronic
930009450 2:46924747-46924769 CTGTAGTCCCAGCTATTCCAGGG - Intronic
930173878 2:48281376-48281398 GTTGCATCACAGATATTCCAGGG + Intergenic
930698295 2:54433376-54433398 CCGGCTACACAGCCATTCCCTGG + Intergenic
933425088 2:82100563-82100585 CTGTAGTCACAGCTATTACATGG + Intergenic
933743819 2:85555521-85555543 CTGGGTTGAAGGCTATTCCATGG - Exonic
936496294 2:113024730-113024752 TCAGCTTCCCAGCTATTCCAAGG - Intronic
937491667 2:122375365-122375387 CTGGATTCACACCCATTTCACGG + Intergenic
937778989 2:125815222-125815244 TTTGCTTCACAGTTATTCTAGGG + Intergenic
939465036 2:142545805-142545827 CTGGCATCCCAACTTTTCCATGG + Intergenic
939539488 2:143475671-143475693 CTGGCTTCACCCCTTTGCCATGG - Intronic
940565187 2:155351522-155351544 CTGGCTTCAGCGCTTTTCCAGGG + Intergenic
940812185 2:158257595-158257617 TTGGCTTCACAATTATTCCTTGG + Intronic
941084437 2:161100362-161100384 CAGGCTTCAAAACTATTCCTTGG + Intergenic
941538370 2:166750612-166750634 CTGGCTTCACAGCACTTGGAAGG + Intergenic
941714494 2:168749436-168749458 CTGTCTTCTCAGCACTTCCAGGG + Intronic
941838690 2:170054847-170054869 AGGGTTCCACAGCTATTCCAAGG + Intronic
943768737 2:191692228-191692250 CTGGGTGCACAGCAATTCCAAGG - Intronic
945426753 2:209714810-209714832 CTGACTTCACAGCTCAGCCATGG - Intronic
946169041 2:217883385-217883407 CTGTTAGCACAGCTATTCCAGGG - Intronic
949019382 2:241732739-241732761 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1169069340 20:2713284-2713306 CTGTCTTCCCTGCTTTTCCATGG - Intronic
1169077673 20:2771434-2771456 CTGGCAACACAGCAATGCCATGG + Intergenic
1171256334 20:23691387-23691409 CAGGCTTCATGGCTATTCTAGGG - Intergenic
1171263690 20:23753297-23753319 CGGGCTGCACGGCTATTCTAGGG - Intergenic
1172358858 20:34298480-34298502 CTGGCGTCACCGCTAGACCAAGG - Intronic
1173884706 20:46446882-46446904 CTGTCTTCACTGATATTGCAGGG + Intergenic
1175080759 20:56418411-56418433 ATGGCTTCAAAGCTCTTACACGG - Intronic
1175272091 20:57741618-57741640 CTGTCTTCACAACGATTCTAAGG + Intergenic
1175379386 20:58552429-58552451 CCGGTTTCACAGCTTCTCCAGGG - Intergenic
1176007395 20:62873847-62873869 CTGGCGTCACCGCTAGACCAAGG - Intergenic
1178167698 21:29999615-29999637 CTTCCTTCACTGCTAGTCCAAGG + Intergenic
1178499393 21:33113235-33113257 CTGGCTTTGCAGCAATGCCAAGG - Intergenic
1179916202 21:44479786-44479808 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1180830838 22:18905334-18905356 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1181464058 22:23101391-23101413 CTGGCTACACAGCAGCTCCAAGG - Intronic
1181464545 22:23103834-23103856 CTGGCTACACAGGTCCTCCAGGG - Intronic
1181676089 22:24454196-24454218 CTGGGACCACAGCTGTTCCAGGG - Intergenic
1181729941 22:24837685-24837707 CTGGCATCACTGCTAGACCAAGG + Intronic
1184344469 22:43904595-43904617 CTGGCATCACCGCTAGACCAAGG + Intergenic
1185031404 22:48445167-48445189 CAGTTTTCACAGCTATTTCATGG - Intergenic
1185336600 22:50273521-50273543 CTGGCGTCACCGCTAGACCAAGG - Intergenic
1203280926 22_KI270734v1_random:130605-130627 CTGGCGTCACCGCTAGACCAAGG + Intergenic
949751142 3:7354071-7354093 CTGGCTTCTCTTTTATTCCAGGG - Intronic
953527306 3:43703299-43703321 CTGTAGTCACAGCTATTCAAAGG - Intronic
953738519 3:45516640-45516662 CTGGCTTCTGAGCTACTCCTAGG + Intronic
956504156 3:69920189-69920211 CTGGCATCACCGCTAGACCAAGG - Intronic
958125117 3:89345958-89345980 ATGGCTGCATAGATATTCCATGG + Intronic
958173264 3:89963491-89963513 ATGGCTGCATAGATATTCCATGG - Intergenic
960593445 3:119387211-119387233 CTGGCTTCACCGCTAGACCAAGG + Intronic
961461230 3:127051693-127051715 CTGTCTCCACAGCCATTCCCAGG + Intergenic
962215951 3:133521901-133521923 CTAGCTTCACAGCTAGTGAATGG + Intergenic
964101369 3:152992216-152992238 CTGGCATCACCGCTAGACCAAGG - Intergenic
965643943 3:170860388-170860410 CTGGCGTCACCGCTAGACCAAGG - Intergenic
965678524 3:171225545-171225567 CTGCCTTCTCAGTTCTTCCAAGG - Intronic
967962383 3:194936494-194936516 CTGGCTTCACAGAAAGTACAAGG - Intergenic
967989984 3:195123498-195123520 CTGCCTGCAGAGATATTCCAGGG - Intronic
968050801 3:195653813-195653835 CTGGCATCACCGCTAGACCAAGG - Intergenic
968105019 3:195994534-195994556 CTGGCATCACCGCTAGACCAAGG + Intergenic
968303320 3:197632125-197632147 CTGGCATCACCGCTAGACCAAGG + Intergenic
968350878 3:198050982-198051004 CTGGCGTCACCGCTAGACCAAGG - Intergenic
968680164 4:1913213-1913235 CTGGCGTTACCGCTAGTCCAAGG - Intronic
969274819 4:6128056-6128078 CTGGCATCACAGCCTTTACAGGG - Intronic
969350837 4:6597027-6597049 CCAGCTTCTCAGCTCTTCCAGGG + Intronic
969642454 4:8407074-8407096 CTGGCATCACTGCTAGACCAAGG + Intronic
970695264 4:18669432-18669454 CTGGCCTTACAGGTATTTCATGG - Intergenic
971660407 4:29407266-29407288 CTGGCTACACAACTATTCACAGG + Intergenic
972251754 4:37309406-37309428 CTGAGTTCACAGCTACACCACGG + Intronic
974164559 4:58184971-58184993 CTGTCATCCCAGCTACTCCAAGG + Intergenic
977742562 4:100504665-100504687 CTGGCGTCACCGCTAGACCAAGG - Intronic
980397109 4:132227970-132227992 CTGGCTTTACCGCTAGACCAGGG + Intergenic
980856869 4:138451106-138451128 CTCGCTTCACTGCTATTCCTGGG + Intergenic
981296638 4:143140529-143140551 CTTGCTTCACCCCTTTTCCAGGG - Intergenic
981547103 4:145904591-145904613 CTGGCTTCAGTGCTGTTCCATGG - Intronic
984119111 4:175720430-175720452 CTGCCTTTTCAGATATTCCATGG - Intronic
984247889 4:177297259-177297281 CTGTAATCCCAGCTATTCCAAGG + Intergenic
985525921 5:401581-401603 CTGGCTTCACAGCTTCACCCTGG - Intronic
986874884 5:12095713-12095735 CTGGCTTGCCAGCCATTCCCAGG + Intergenic
987127218 5:14825248-14825270 CTAACTACTCAGCTATTCCATGG + Intronic
987359307 5:17092409-17092431 CTGGCCTCACACCTACTCCCAGG + Intronic
989272747 5:39552029-39552051 CAGGCTACACTGCAATTCCAAGG - Intergenic
989339016 5:40353935-40353957 CTGGCTTCTCAGCGCTTCCACGG + Intergenic
991989442 5:72323025-72323047 CTGTAGTCACAGCTACTCCAGGG + Intronic
992614276 5:78534380-78534402 CAGGCTGCACTGCTCTTCCAGGG + Intronic
992759020 5:79935158-79935180 CTGAATTCACAGCCATTCCGGGG + Intergenic
994055887 5:95414629-95414651 CTGGCCTCCCAGCTGTTCCTAGG + Intronic
995250501 5:109987592-109987614 CTTGCTTCACAGCTGTGCCACGG + Intergenic
997242205 5:132315655-132315677 CTGGCTTGACTGATCTTCCATGG - Intronic
997972010 5:138411181-138411203 CTGGCGTCACCGCTAGACCAAGG + Intronic
998330693 5:141323791-141323813 CTGGTATCACAGATATTCCATGG - Intergenic
998539364 5:142965444-142965466 CTGGCATCACCGCTAGACCAAGG + Intronic
998947739 5:147359219-147359241 CTGGTTTCTCAGCTATTTGAGGG + Intronic
999063983 5:148665350-148665372 CTGGCCTCACAGTCCTTCCACGG + Intronic
1001535276 5:172493660-172493682 ATGGCTTCACAGGTTGTCCAAGG - Intergenic
1001724830 5:173888195-173888217 CTCGCTTCAGAGCTACTCCCAGG - Intergenic
1001817569 5:174682926-174682948 CTGTAGTCACAGCTACTCCAGGG + Intergenic
1003389981 6:5705523-5705545 CTGGCTGCACAGCAAATTCAGGG - Intronic
1004381637 6:15137737-15137759 CTGTAGTCCCAGCTATTCCAGGG + Intergenic
1004896432 6:20152544-20152566 CTGGCTTTAGTGCAATTCCAAGG + Intronic
1006054614 6:31374317-31374339 CTGGCATCACCGCTAGACCAAGG + Intergenic
1006586272 6:35116108-35116130 CTGGCTTCTCAGCTAGTTGAGGG + Intergenic
1006586474 6:35117998-35118020 CTGGCTTCTCAGCTAGTTGAGGG + Intergenic
1007166173 6:39830588-39830610 CTTGCTTCCCAGCTATTCCCAGG - Intronic
1007252122 6:40502873-40502895 CTAGCTTCAGAGCTCTTCCTGGG - Intronic
1007420850 6:41718755-41718777 GTGGCTCCAAATCTATTCCAGGG - Intronic
1008216665 6:48798000-48798022 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1008571091 6:52817303-52817325 CTGGTTTCACAGCCACTTCATGG - Intergenic
1009505252 6:64469586-64469608 CTGGCGTCACCGCTAGACCAAGG - Intronic
1010098453 6:72075040-72075062 CTGTCTTCCCAGCTACTTCAGGG - Intronic
1010119241 6:72354278-72354300 CTGTCTTCTTAGCTACTCCATGG + Intronic
1010260927 6:73816062-73816084 CAGCCTTCACAGCTATTGCCTGG + Intronic
1010264623 6:73852437-73852459 ATGGCTTCTCAGGTATTCAAGGG + Intergenic
1011328354 6:86175318-86175340 CTGGCATCACCGCTAGACCAAGG + Intergenic
1011735356 6:90304780-90304802 CTGGATTTACAGCTCTTCCCAGG + Intergenic
1012870870 6:104671241-104671263 CTGGCTTCACCCCCTTTCCAGGG - Intergenic
1014902378 6:126983828-126983850 CTGGCTTCACACCCTTTCCAGGG - Intergenic
1015363296 6:132366883-132366905 CTGGCTTCAAGGACATTCCATGG + Intronic
1016661962 6:146592071-146592093 CAGGATTAACAGCTATTCTATGG + Intergenic
1019623077 7:2002083-2002105 CTGGCCTCCCAGCTCCTCCAGGG + Exonic
1022567044 7:31413838-31413860 CAGTGTTCACAGCTGTTCCATGG + Intergenic
1024480234 7:49855085-49855107 CTATCTTCACAGCTGTACCAAGG - Intronic
1026731816 7:72918352-72918374 CTGGCGTCACTGCTAGACCAAGG + Intronic
1029487032 7:100849591-100849613 CTGTCATCCCAGCTACTCCAAGG + Intronic
1029574567 7:101394993-101395015 CTGTAATCACAGCTATTCAAGGG - Intronic
1029880631 7:103805878-103805900 CTTTCTTAACAGCTATTCCATGG + Intronic
1030211445 7:107000012-107000034 ATTTCTTCACAGCTATTCAACGG + Intergenic
1031973527 7:128079933-128079955 CTGGCACTACAGCTCTTCCAGGG - Intronic
1033785637 7:144727030-144727052 CTGGCGTCACCGCTAGACCAAGG - Intronic
1037057195 8:14457315-14457337 CTGGCGTCACCGCTAGACCAAGG - Intronic
1038368074 8:26957403-26957425 CTCTCTTGACAGCTATTCCTTGG - Intergenic
1041060639 8:54031365-54031387 CTGTAGTCACAGCTACTCCAAGG - Intergenic
1042174613 8:66026818-66026840 CTTGCTTCACAGCTGTGCCAAGG - Intronic
1044182822 8:89217075-89217097 CTGTCATCCCAGCTAATCCAGGG + Intergenic
1047506034 8:125481220-125481242 CTGGCTCCAGAGCCATTGCATGG - Intergenic
1048207765 8:132429251-132429273 CAGGCTTAACAGCTAGCCCATGG + Intronic
1049755389 8:144309215-144309237 CCGGCTTCACGGTTCTTCCATGG - Intronic
1050331742 9:4552717-4552739 AAGGTTTCACAGCTAATCCATGG - Intronic
1050793479 9:9505472-9505494 CTGGCATCAAATTTATTCCAGGG - Intronic
1056314958 9:85379293-85379315 ATGGATTCACTTCTATTCCATGG + Intergenic
1056376511 9:86018828-86018850 CTGGATTCACAGTAATTCTAGGG + Intronic
1057697942 9:97340680-97340702 CTGGCGTCACCGCTAGACCAAGG - Intronic
1057724819 9:97561041-97561063 CTGGCTTCACAGGCCTTCCCTGG - Intronic
1057961410 9:99461161-99461183 GAGGCTTCACATCTAGTCCATGG - Intergenic
1060630041 9:125148267-125148289 CTGGCTTCACAAGTATTTCCTGG + Exonic
1061039249 9:128130143-128130165 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1061048720 9:128181646-128181668 CTGGCGTCACCGCTAGACCAAGG - Intronic
1061651655 9:132055084-132055106 CTGCCTTCACAGCGCTTCCAGGG - Intronic
1061676175 9:132216990-132217012 CTGGCTTCGCGTCCATTCCATGG - Intronic
1061835907 9:133329504-133329526 CTGGCGTCACCGCTAGACCAAGG + Intergenic
1062101987 9:134733285-134733307 CGGGCTTCAAAGAGATTCCAGGG - Intronic
1062477257 9:136734652-136734674 CTGGCATCACCGCTAGACCAAGG + Intergenic
1062531730 9:137004459-137004481 CTGGCGTCACCGCTAGACCAAGG - Intergenic
1062557174 9:137118866-137118888 CTGGCATCACCGCTACACCAAGG - Intergenic
1062588512 9:137262358-137262380 CTGGCGTCACCGCTAGACCAAGG + Intronic
1062639324 9:137510075-137510097 CTGGCGTCACCGCTAGACCAAGG - Intronic
1062647936 9:137559292-137559314 CTGGCGTCACCGCTAGACCAAGG - Intronic
1062688158 9:137827048-137827070 GTGCCTTCACACCTGTTCCATGG + Intronic
1186913423 X:14193954-14193976 TTTGCTTCACAGCTATTGAAGGG - Intergenic
1188531772 X:31149178-31149200 CTGGCTTCATAGTTTATCCATGG - Intronic
1191739675 X:64423475-64423497 CTTCCTTTACAGCAATTCCATGG - Intergenic
1193611394 X:83635415-83635437 CTGGCGTTACCGCTATACCAAGG + Intergenic
1194141081 X:90210402-90210424 CCAGCTTCACAGCTCTCCCATGG - Intergenic
1197051857 X:122068725-122068747 CTGGGTACACAGCAATTCCTGGG + Intergenic
1197242678 X:124136747-124136769 CTGGCGTCACCGCTAGACCAAGG - Intronic
1197550705 X:127889166-127889188 ATGGCTTTACAGATATTCAAGGG + Intergenic
1198300273 X:135327628-135327650 TTGGCCTCAGAGCTATTCCCTGG + Intronic
1198493672 X:137168808-137168830 TTTGCTTCACAGCTATTGTAAGG - Intergenic
1198680576 X:139177705-139177727 CTGGCTTCAGCCCTTTTCCAGGG + Intronic