ID: 1067994175

View in Genome Browser
Species Human (GRCh38)
Location 10:51251220-51251242
Sequence CAATTTATGAAACAGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067994175_1067994179 27 Left 1067994175 10:51251220-51251242 CCAGGCACCTGTTTCATAAATTG 0: 1
1: 0
2: 1
3: 18
4: 151
Right 1067994179 10:51251270-51251292 AGTCTGACAGAATCAAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067994175 Original CRISPR CAATTTATGAAACAGGTGCC TGG (reversed) Intronic
902547281 1:17197981-17198003 TAATATATGTAAAAGGTGCCTGG - Intergenic
902855675 1:19202772-19202794 CAATTGATGAAACATGGGCCGGG + Intronic
902888623 1:19425200-19425222 CATTGTATGAAGGAGGTGCCTGG - Intronic
905272361 1:36795365-36795387 CAATGTCTGAACCAGGAGCCTGG + Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
909413319 1:75378518-75378540 CAATCTATTAAACAGCTTCCAGG - Intronic
910595929 1:88980635-88980657 CTATTTATCAAACAGGTGTCTGG + Exonic
911028089 1:93456472-93456494 CAATTTATAGAAAAGGAGCCAGG + Intronic
911111716 1:94195333-94195355 CAGTTTATGACAGTGGTGCCAGG + Intronic
911392265 1:97260602-97260624 TAATTTATGAAATAGTTGCATGG + Intronic
919228232 1:194737331-194737353 GAAATCATGAAAAAGGTGCCTGG - Intergenic
923418811 1:233792035-233792057 CATTTTCTGAAACAGATGACTGG + Intergenic
924627954 1:245711402-245711424 CAGTGAATGAAACAGGTTCCAGG + Intergenic
1065507091 10:26439455-26439477 CAAATTATGAAACTTGTGCCTGG - Intronic
1065649250 10:27870292-27870314 CACTTTAGGAAACAGTTTCCAGG - Intronic
1066283349 10:33939994-33940016 TAAGTTTTGAAACAGGGGCCTGG - Intergenic
1067894274 10:50162446-50162468 CAATTTGAGAAGCAGGTGTCAGG - Intergenic
1067954568 10:50777815-50777837 CAATTTGAGAAGCAGGTGTCAGG + Intronic
1067994175 10:51251220-51251242 CAATTTATGAAACAGGTGCCTGG - Intronic
1069456716 10:68560060-68560082 AAATGTATGAAGAAGGTGCCAGG - Intergenic
1071223201 10:83494120-83494142 CAATTTTTGAAACAGAAGACTGG - Intergenic
1077410601 11:2402223-2402245 ACATGTGTGAAACAGGTGCCGGG - Intronic
1078764448 11:14280819-14280841 CAGAGTATGAAACAGGGGCCAGG + Intronic
1079781135 11:24607435-24607457 TAATTTTTGACAAAGGTGCCAGG - Intronic
1081616220 11:44592930-44592952 CAAGTTAGGAAAAAGCTGCCTGG - Intronic
1085289013 11:75384092-75384114 AAAATAATGAAACAGGGGCCGGG - Intergenic
1087049018 11:93867766-93867788 CCATACTTGAAACAGGTGCCAGG + Intergenic
1087723859 11:101696495-101696517 CAATCTATTAAACAGCTTCCAGG - Intronic
1089471979 11:118728721-118728743 CAATCTATTAAACAGCTTCCAGG + Intergenic
1089957263 11:122583138-122583160 CCATTTATTAAATAGGTGCTGGG + Intergenic
1091021937 11:132107900-132107922 CAATTTATGAAAGAGATTCCAGG - Intronic
1093592171 12:20916040-20916062 CAATATATAAAACAAGTGCTGGG - Exonic
1094114315 12:26893814-26893836 CATTTAATGAACCATGTGCCAGG - Intergenic
1094626722 12:32131520-32131542 CATTTTGTGAAACAGTTGCATGG + Intronic
1095492945 12:42755276-42755298 CAATATATAAAACAGATGACTGG + Intergenic
1097056544 12:56253487-56253509 CTATGTATGCATCAGGTGCCAGG + Intronic
1097224456 12:57469045-57469067 CTATTTAAGAAAGAGTTGCCGGG - Intronic
1098359074 12:69637608-69637630 CAAGTCATGAAACAGGTCCAGGG + Intergenic
1102135588 12:110571469-110571491 CAATCTATTAAACAGCTTCCAGG - Intronic
1102226126 12:111229515-111229537 CATTTTATGGAACAGGAGACAGG - Intronic
1103396979 12:120615104-120615126 TAATTTTTGACAAAGGTGCCAGG - Intergenic
1103844047 12:123888919-123888941 CAATCGATGAAATAGGTCCCTGG - Intronic
1108436419 13:50405711-50405733 AAATTAATGAAACAGGTGGATGG + Intronic
1109315657 13:60746032-60746054 GAATTTGTGAAACAGCTGCATGG + Intergenic
1110233436 13:73191227-73191249 CAAGTTATGTAACTGATGCCTGG - Intergenic
1113369387 13:109708853-109708875 CAATTTATGAAACAGATTTCAGG - Intergenic
1114288308 14:21266793-21266815 CAATTTAGAAAACCGGGGCCGGG + Intronic
1118015300 14:61654366-61654388 CCATTTATGAAATAGCTGTCCGG + Exonic
1118308770 14:64677321-64677343 CAATTTCTGACAGTGGTGCCTGG - Intergenic
1121990550 14:98552831-98552853 CAATTTCTGAAACAGGTGCTTGG - Intergenic
1122105524 14:99451324-99451346 CAGTTTGTGAAACAGAGGCCAGG - Intronic
1123160754 14:106276016-106276038 CGATTTATGACACTGGTGCAGGG + Intergenic
1124258426 15:28164880-28164902 CTATTTATGAATTAGGTGCCTGG - Intronic
1128698394 15:69786305-69786327 CAACTGAGGAAACAAGTGCCAGG - Intergenic
1130200966 15:81826472-81826494 CAGTGTATGAGCCAGGTGCCAGG - Intergenic
1130832457 15:87615551-87615573 CAATGTTTGGAACAGGTGCTTGG - Intergenic
1132778360 16:1609632-1609654 CAATATAAGAAACGGGTTCCAGG + Intronic
1133694924 16:8253897-8253919 TCATTTACGAAACAGGTGGCAGG - Intergenic
1137946086 16:52734447-52734469 CAATTTCTGGAACAGGGGCTGGG + Intergenic
1146296320 17:31653433-31653455 CCATCTATGAAATAGGCGCCAGG + Intergenic
1146315289 17:31802156-31802178 CATTTTCAGAAACTGGTGCCAGG - Intergenic
1147522629 17:41189100-41189122 CAATTCCTGAAACAGGGGACTGG - Intergenic
1148392888 17:47285938-47285960 CAACCTATGAAAGAGGGGCCAGG - Intronic
1149202138 17:54199184-54199206 ACATTTATGATACATGTGCCTGG - Intergenic
1150710825 17:67529583-67529605 CAACTCATGCAACAGGTGCAGGG - Intronic
1152548418 17:81015226-81015248 CAATTACTGAAAGAGGGGCCAGG - Intergenic
1155901272 18:31394057-31394079 CTATTTATGAAACAGGGGACAGG - Intronic
1158637240 18:59170889-59170911 TAATTTTTGACAAAGGTGCCAGG + Intergenic
1158640161 18:59196818-59196840 CAATTTCTGAACCAGTTGCCAGG + Intergenic
1164960122 19:32420744-32420766 CAATTTATTAAACACATGGCAGG - Intronic
1165857402 19:38888048-38888070 CGAATTATAAAACAGGTGGCCGG - Intronic
1166060852 19:40324562-40324584 AAATTTATGGAACATGGGCCAGG + Intronic
926225204 2:10962109-10962131 CAATCTATGACACAGCTGCTGGG + Intergenic
926416001 2:12650368-12650390 CAGTTCATAAAACAGGGGCCAGG + Intergenic
927913645 2:26919317-26919339 CATTTTATGACACAGTTTCCAGG - Intronic
930558254 2:52927636-52927658 TAATTTAGGCAACAGGTGGCGGG - Intergenic
933646382 2:84816039-84816061 CACTTTATAAAACAGGAGCCCGG + Exonic
936341029 2:111632924-111632946 CAATTGCTCAAACTGGTGCCGGG - Intergenic
936566742 2:113588220-113588242 CAATGTATGGAAAGGGTGCCTGG + Intergenic
936574960 2:113645285-113645307 CAATTTAGGACCCAGGTCCCAGG + Intergenic
937822667 2:126328272-126328294 AAATTTATGAAATAGGGGCAAGG + Intergenic
939564230 2:143767644-143767666 CAATTGAGGAAACAGGTGAGAGG - Intronic
942855288 2:180538788-180538810 CAATTCATGAAACATCTCCCCGG + Intergenic
943714700 2:191137730-191137752 TAATTTTTGACAAAGGTGCCAGG + Intronic
944396753 2:199276705-199276727 CAATTTATGAAAAAGCTGGCAGG + Intronic
947110705 2:226716289-226716311 AACTTTATGAAACTGGGGCCAGG + Intergenic
1169021329 20:2333311-2333333 CAATATATGAAGCAACTGCCTGG + Intronic
1169829167 20:9804429-9804451 TGATTTATGACAAAGGTGCCAGG + Intronic
1169988082 20:11469351-11469373 CCATCTATGACACAGGTGGCAGG + Intergenic
1171003317 20:21436929-21436951 GAATTTATGACACAAGAGCCTGG - Intergenic
1172410135 20:34715170-34715192 CACTTTATGAAACAGGTTGCAGG + Exonic
1174240843 20:49133485-49133507 CCTTTCCTGAAACAGGTGCCGGG + Intronic
1177797503 21:25794098-25794120 CAATATATGAATCAGGGGCTTGG + Intergenic
1179833115 21:44011002-44011024 CATTCTATGAAACTGGTCCCTGG + Intergenic
1180837866 22:18940106-18940128 CAATCTATTAAACAGCTTCCAGG - Intergenic
1184832680 22:46999605-46999627 CAAGTGATGAAACAGGTGAGGGG - Intronic
1185290624 22:50024924-50024946 TAATTTTTGGAGCAGGTGCCAGG + Intronic
1185425214 22:50765590-50765612 CAATTTAGGACCCAGGTCCCAGG - Intergenic
950807767 3:15621894-15621916 CAATTTAAGAAACTGATGTCCGG - Intronic
952270473 3:31826097-31826119 CAATTTATGGAACTGGGGCTAGG - Intronic
955068227 3:55550719-55550741 TAATTTAAGAAATAGGGGCCGGG + Intronic
957784926 3:84870109-84870131 CAATTAAAGAAACAGATACCAGG - Intergenic
957981232 3:87513533-87513555 CAGTTTATGAAACATAAGCCAGG - Intergenic
959621211 3:108400360-108400382 CAATTCATGAAACAGGGACCTGG + Intronic
961296854 3:125891726-125891748 CAATCTATTAAACAGCTTCCAGG - Intergenic
963696075 3:148567123-148567145 CAATCTATTAAACAGCTTCCAGG + Intergenic
965308637 3:167100227-167100249 CAATATATGAAACGGGTGGTGGG + Intergenic
966327600 3:178774384-178774406 CAATATATGGAACAGGAACCTGG - Intronic
967734420 3:192936936-192936958 CTATTCATGAAGCAGGTGCAAGG - Intergenic
968038216 3:195566698-195566720 GAATTTATGAGGCAGGTGTCAGG - Intergenic
971291793 4:25349134-25349156 CAATTTAACAAACAGAAGCCAGG - Intronic
975137627 4:70889962-70889984 TAATATATGAAACAGATGACTGG + Intergenic
976264178 4:83174596-83174618 TAATTTATTAAACTGGTGTCAGG + Intergenic
978901553 4:113956208-113956230 TACTTTATGAAACATGTGCTTGG + Intronic
979370547 4:119880991-119881013 CAATTTATGAAATATCTGGCTGG - Intergenic
982882315 4:160734837-160734859 CCATCTATGAACCAGGTGGCAGG + Intergenic
983175173 4:164579706-164579728 TAATTAATTAAACAGTTGCCTGG + Intergenic
983999836 4:174226512-174226534 CCAATTATGAGGCAGGTGCCTGG + Intergenic
984325693 4:178247698-178247720 CAATCTCTGAAACAGGTGAGAGG - Intergenic
984866229 4:184282984-184283006 CATTTTTAGAAACAAGTGCCTGG - Intergenic
986835348 5:11630991-11631013 AGATGTATGAAACAGGTGACTGG - Intronic
988380779 5:30494661-30494683 CAATCTATTAAACAGCTTCCAGG + Intergenic
989042678 5:37245591-37245613 CATTTTTGGAAACAGATGCCTGG - Exonic
990882048 5:60549467-60549489 CAATTTTTGACAAAGTTGCCAGG + Intergenic
992195659 5:74336525-74336547 CTGTGTATGAAACAGCTGCCGGG + Intergenic
995649740 5:114357094-114357116 CAATATGGGAAACAGATGCCAGG + Intergenic
995662322 5:114499197-114499219 CATTTAATGAAATAGATGCCAGG - Intergenic
998439151 5:142141818-142141840 CAATTTATTAAACACCTGCCAGG - Intronic
999219630 5:149963876-149963898 CAATATATAAAACAGAGGCCAGG - Intronic
999952476 5:156665431-156665453 CAATCTATTAAACAGCTTCCAGG + Intronic
999959014 5:156734462-156734484 CAATTTAGAAAACATGTTCCAGG - Intronic
1000474531 5:161689063-161689085 CCATTTCTGAAAAAGGTGTCAGG - Exonic
1003046581 6:2739028-2739050 CAACATATGAAACAGGTGCTTGG - Intronic
1003544043 6:7043599-7043621 CAAATTATTAAAAAGTTGCCGGG + Intergenic
1004206337 6:13594788-13594810 CAGTTTATGAAATGGGTACCAGG - Intronic
1005150713 6:22746650-22746672 CCACTTATGAAACAGGTGGAAGG + Intergenic
1006759183 6:36444116-36444138 AAATTTATGGAAGAGGTGCTAGG - Intronic
1008085190 6:47236930-47236952 GAATTTAGGAAACAGGTGAGTGG - Intronic
1008171344 6:48211344-48211366 CTATTTATCAAACAGGTGTCTGG + Intergenic
1010619373 6:78055370-78055392 CAATATATGCAACAGGAGCCAGG - Intergenic
1011982216 6:93393926-93393948 AAATTTATGAAAAAGCTGTCTGG - Intronic
1013036415 6:106388333-106388355 AAATTTATGAAATAAGTGCATGG - Intergenic
1015983765 6:138865526-138865548 CAATTTATGTAATAGGTGCTGGG - Intronic
1016024621 6:139273385-139273407 CAATTTATGAAACACCTGTAGGG - Intronic
1016486165 6:144542208-144542230 GAGTTTATGAAACGGGTGTCAGG + Intronic
1023604705 7:41918976-41918998 CAGGTTATGAAAGAGGTGGCTGG + Intergenic
1024514743 7:50236984-50237006 CAATTTACCAAACAGGAGGCAGG - Intergenic
1029967221 7:104752336-104752358 CAATCTATTAAACAGCTTCCAGG + Intronic
1036292480 8:7505891-7505913 CAATCTATTAAACAGCTTCCAGG + Intronic
1038105927 8:24433949-24433971 CAATTTATAAATAAGGTGCAGGG + Intergenic
1038930739 8:32191044-32191066 CAATTCTTGAAACAATTGCCTGG + Intronic
1041817150 8:61986877-61986899 TAATTTTGGAAACAGCTGCCTGG + Intergenic
1043625233 8:82248879-82248901 CACCTTGTGAAGCAGGTGCCTGG + Intergenic
1048947447 8:139462507-139462529 CAATCTATTAAACAGCTTCCAGG + Intergenic
1051487686 9:17626202-17626224 CAATAAAAGAAGCAGGTGCCAGG - Intronic
1057960423 9:99450806-99450828 AACTTTATGAAACAGGTTTCTGG - Intergenic
1058426597 9:104880672-104880694 GAATTTAAGAAACAGCTGCAAGG + Intronic
1060192749 9:121603435-121603457 CATTTTATGAAAGAGGTCACTGG + Intronic
1060355918 9:122906805-122906827 CTCTTTATGAAACATATGCCAGG + Intergenic
1062011440 9:134269105-134269127 GAATTTATAATGCAGGTGCCAGG + Intergenic
1186028504 X:5340873-5340895 CAATGTATCAAAGTGGTGCCAGG + Intergenic
1186330991 X:8534122-8534144 CAATGTATACTACAGGTGCCTGG + Intronic
1187450861 X:19395083-19395105 ATATTTATGGAGCAGGTGCCTGG - Exonic
1188337463 X:28955181-28955203 CATTTTATCAAACACGTGACAGG + Intronic
1190855525 X:54290489-54290511 CAAATTATCAAAAAGGTGCTAGG + Intronic
1197429004 X:126336251-126336273 CAACTTATTAAATTGGTGCCTGG + Intergenic
1199187781 X:144937714-144937736 TAATTTAAGAATCAGTTGCCAGG + Intergenic
1199387761 X:147242793-147242815 CAATTTAAGAAATAGGTACAAGG + Intergenic
1201431619 Y:13908488-13908510 CAATGTATACTACAGGTGCCTGG - Intergenic
1201478292 Y:14408815-14408837 CTATTTAAGAAAGAGGTGGCCGG + Intergenic
1201635746 Y:16120739-16120761 CAATTTATAAAACAAGGGCGGGG - Intergenic