ID: 1067995117

View in Genome Browser
Species Human (GRCh38)
Location 10:51263420-51263442
Sequence AAGCAACTTCACCACTGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067995117 Original CRISPR AAGCAACTTCACCACTGAGG CGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
903455328 1:23483599-23483621 AAGAAAGTTCAGGACTGAGGCGG + Intronic
903893213 1:26584173-26584195 AAGGAACTTGACCCCTGAGAAGG - Intergenic
904323121 1:29709487-29709509 CAGCAAGGTCACCACAGAGGAGG - Intergenic
906354290 1:45090708-45090730 TAGCTACTTCAGGACTGAGGTGG + Intronic
906571488 1:46845585-46845607 AAGCATCTTCACAGTTGAGGGGG - Intergenic
906752216 1:48275195-48275217 AAGCAACTTCAGCACAGTGTCGG - Intergenic
907252524 1:53150461-53150483 CAGCAATTTCACCAAAGAGGAGG - Intergenic
907282857 1:53362364-53362386 AGGCAAATTCAGCACAGAGGTGG + Intergenic
909603981 1:77490284-77490306 AAGCAACTTTTCCCCTGAGCTGG + Intronic
913225760 1:116696775-116696797 AGGCACTTTCACCAGTGAGGAGG - Intronic
914941149 1:152023874-152023896 AAGCAATTTCAGCAATGGGGAGG + Intergenic
916024700 1:160823580-160823602 CAGCAACCTCACAACTGAGGAGG + Exonic
917027353 1:170659021-170659043 AAGCAATTTCCTCTCTGAGGTGG - Intergenic
917737764 1:177936185-177936207 AAGCTGCTGCAACACTGAGGAGG + Intronic
918341044 1:183568131-183568153 AAGCAACTACAAAAATGAGGGGG - Intronic
918462457 1:184790362-184790384 AATCAAGTTCACCAGTGAGGGGG - Intergenic
919220152 1:194617696-194617718 AGCCAGCTTCACCTCTGAGGTGG + Intergenic
922782555 1:228264418-228264440 AAGCACCATCACCTCTGAAGAGG - Intronic
923358617 1:233185275-233185297 AAGGAACTTCATAACTGAGATGG + Intronic
923792304 1:237122219-237122241 GAGGGACTTCACCACTGATGTGG - Intronic
924225513 1:241918624-241918646 AAGCTGCTTCATCACTGTGGTGG - Intergenic
1067142422 10:43668426-43668448 AACCACCTGCACCCCTGAGGCGG + Intergenic
1067995117 10:51263420-51263442 AAGCAACTTCACCACTGAGGCGG - Intronic
1068614105 10:59092903-59092925 AAACTACATCAGCACTGAGGAGG + Intergenic
1071153322 10:82661929-82661951 AAACAGCTTCACCACTGATGAGG - Intronic
1072675952 10:97466283-97466305 AAGTACCTACACCACTGAGTTGG + Intronic
1072903226 10:99427994-99428016 AGGCACCTTCACAGCTGAGGTGG + Intronic
1076021375 10:127076696-127076718 GAGCAGCTCCACCAATGAGGTGG - Intronic
1077231993 11:1461901-1461923 AAGCAGCTCCACCTCTGGGGGGG + Intronic
1080859763 11:36143072-36143094 ATGCATATTCACCAGTGAGGCGG + Intronic
1081748501 11:45489673-45489695 AAGCAGCTTCACTCCTGAAGAGG + Intergenic
1084756332 11:71241135-71241157 AGGCAACTTCTCCTCTAAGGAGG + Intronic
1084791429 11:71477504-71477526 CAGCACCTGCACCACTGCGGCGG - Intronic
1086580456 11:88392648-88392670 AAGCAACTTCAGAACTGCAGAGG - Intergenic
1089665217 11:120013859-120013881 CACCAGCATCACCACTGAGGGGG + Intergenic
1091842768 12:3632547-3632569 AAGCATCTTCACCTCTCATGGGG + Intronic
1094844553 12:34355723-34355745 TGGCAACTTCACCAGTGTGGGGG + Intergenic
1096024591 12:48350369-48350391 AAGCAACCTTACCCCTGAGCAGG - Exonic
1096932866 12:55234473-55234495 AAGCAATTTCTTCACTGAGATGG - Intergenic
1099094929 12:78363219-78363241 AAGCTACTTCATTACTGATGGGG + Intergenic
1099497188 12:83363643-83363665 AGGCAAGTTAACCACAGAGGAGG + Intergenic
1103456238 12:121068199-121068221 AAGCAACTGGACCACTCTGGAGG - Intergenic
1104188821 12:126458289-126458311 AATCAAGTTCCCCAATGAGGGGG + Intergenic
1105206627 13:18231123-18231145 AATTAACTTCACAACTGAAGTGG - Intergenic
1113713477 13:112487018-112487040 AAGTAACTTCACCTCTGAGCAGG + Intronic
1117197113 14:53351738-53351760 GAGCATATTCACCACTCAGGAGG - Intergenic
1117338722 14:54776197-54776219 CAGCAAGGCCACCACTGAGGAGG + Intronic
1119892161 14:78191153-78191175 AAGCAAATTCACAACTGGTGGGG + Intergenic
1120830936 14:88996736-88996758 AAGCAAGTGGACCAATGAGGTGG - Intergenic
1124357287 15:29005052-29005074 AAGCAACTGCACCACCTGGGGGG - Intronic
1128332637 15:66765893-66765915 CTGCAAGTTCCCCACTGAGGAGG + Intronic
1130268007 15:82426701-82426723 AAGAAAATTCACCTCTGGGGTGG - Intergenic
1130476180 15:84269997-84270019 AAGAAAATTCACCTCTGGGGTGG - Intergenic
1130483600 15:84384051-84384073 AAGAAAATTCACCTCTGGGGTGG - Intergenic
1130504017 15:84520133-84520155 AAGAAAATTCACCTCTGGGGTGG + Intergenic
1133749078 16:8710748-8710770 AAGCACCTTCACATCTGAGCAGG + Intronic
1134367842 16:13595737-13595759 ACCCAACTTCACCGCTGTGGGGG + Intergenic
1137955709 16:52827089-52827111 AAGCAACCTCAAAACTGAGCTGG + Intergenic
1148620240 17:49029266-49029288 AAGCTTCCTTACCACTGAGGAGG + Intronic
1150515064 17:65799638-65799660 AAGCAACTACAGTTCTGAGGAGG + Intronic
1151541007 17:74764495-74764517 AATCCCCTTCTCCACTGAGGGGG + Intronic
1152988465 18:340883-340905 AAGCACCTTGTCCACAGAGGAGG + Intronic
1153475002 18:5489348-5489370 TGTCAACTTCACCACTGAGATGG + Intronic
1154141070 18:11825082-11825104 AAGAAACTTCAGTACTGAGAAGG - Intronic
1155572649 18:27212347-27212369 TAGAGACTTCACTACTGAGGGGG + Intergenic
1155593465 18:27454492-27454514 AACCAGCCTCCCCACTGAGGTGG - Intergenic
1156393402 18:36674514-36674536 AAGCAGCTTCACCAGTGAACAGG - Intronic
1160344071 18:78116082-78116104 AAGCAACTTGAGAACTGAAGAGG + Intergenic
1160925545 19:1543259-1543281 AATCACTTTCACCACGGAGGCGG + Intergenic
1162495072 19:11018995-11019017 AGACACCTTCACCACGGAGGGGG - Exonic
1163907900 19:20163029-20163051 AAGGAACTGCACCATTGAGTGGG - Intergenic
1163910131 19:20182208-20182230 AAGCAACTTCAGCATTGACAGGG + Intronic
1163936424 19:20448757-20448779 AAGCAACATCAGCACTGACAGGG + Intergenic
1163984373 19:20931187-20931209 AAGCAACATCAGCACTGACAGGG + Intronic
1166290327 19:41859690-41859712 AAGCAACTTCCGCCCTGAGAAGG + Intergenic
1168103263 19:54152382-54152404 ACCCATCCTCACCACTGAGGGGG + Intronic
1168643821 19:58047188-58047210 AGGCATCTTCAGCCCTGAGGGGG - Intronic
926724387 2:15986260-15986282 CAGCAAGTTCACCTCTGCGGGGG - Intergenic
930376749 2:50576872-50576894 GAGCTACTTAACCACAGAGGAGG - Intronic
931129157 2:59313890-59313912 AAGCAGCTTGATCAATGAGGGGG - Intergenic
936012443 2:108933696-108933718 CAGCGAGTTCACCACTGGGGTGG - Intronic
940327425 2:152440285-152440307 AAGCAACTTCCCAGCTGAGTTGG - Intronic
940419658 2:153465034-153465056 AATAGACTTCACCACTGTGGAGG - Intergenic
940926119 2:159365358-159365380 AAGGAACTTCACCAAAGTGGAGG - Intronic
941205203 2:162563442-162563464 AAGCAAAACCACCACTGAGAAGG - Intronic
941396895 2:164984261-164984283 AGGAAACTTCACCACAGAGCAGG - Intergenic
947075897 2:226345475-226345497 TAGCAACTTCACCACTGCCAAGG - Intergenic
948303556 2:236928886-236928908 AAGCAACTTCTCCACTAGTGAGG - Intergenic
948319659 2:237059230-237059252 ACGCTCCTTCACCACTGAGCTGG - Intergenic
948360401 2:237415994-237416016 CTGCAACTTCAGCACTAAGGAGG + Intergenic
1169013851 20:2275147-2275169 AAGCCACTTCATCCCTGAAGAGG + Intergenic
1169925626 20:10781331-10781353 AAGCAAGCTCAGAACTGAGGAGG + Intergenic
1170385535 20:15812114-15812136 AAGCAGCTTAAACACTGAGCTGG - Intronic
1170896577 20:20420308-20420330 GAGGAACTGCACCACTAAGGAGG + Intronic
1172002270 20:31788544-31788566 AAACAGCTTCAGCACTGGGGGGG - Intronic
1175628318 20:60509086-60509108 CAGCCACTTCACCAACGAGGAGG - Intergenic
1176016343 20:62935535-62935557 AAGCCACGTCTCTACTGAGGAGG + Intronic
1176285840 21:5019076-5019098 AAGCCACATGGCCACTGAGGCGG + Intergenic
1177322965 21:19545935-19545957 CAGCTACTTGGCCACTGAGGTGG - Intergenic
1178135762 21:29625575-29625597 AAGTAACTTAAGTACTGAGGTGG + Intronic
1179871341 21:44244399-44244421 AAGCCACATGGCCACTGAGGCGG - Intergenic
1180759316 22:18187581-18187603 AATTAACTTCACAACTGAAGTGG + Intergenic
1180769624 22:18371877-18371899 AATTAACTTCACAACTGAAGTGG + Intergenic
1180776704 22:18490789-18490811 AATTAACTTCACAACTGAAGTGG - Intergenic
1180809431 22:18748155-18748177 AATTAACTTCACAACTGAAGTGG - Intergenic
1180827564 22:18874840-18874862 AATTAACTTCACAACTGAAGTGG + Intergenic
1181072352 22:20353141-20353163 AATTAACTTCACAACTGAAGTGG - Intronic
1181195423 22:21182075-21182097 AATTAACTTCACAACTGAAGTGG - Intergenic
1181214024 22:21310699-21310721 AATTAACTTCACAACTGAAGTGG + Intergenic
1181524470 22:23472332-23472354 AATTAACTTCACAACTGAAGTGG + Intergenic
1184129952 22:42511872-42511894 ATGCAACTTCACAACTCAGCTGG + Exonic
1184140128 22:42573690-42573712 ATGCAACTTCACAACTCAGCTGG + Intronic
1185414357 22:50701649-50701671 AAGCCTCATCACCACTCAGGTGG - Intergenic
1203231455 22_KI270731v1_random:113064-113086 AATTAACTTCACAACTGAAGTGG + Intergenic
1203277661 22_KI270734v1_random:100830-100852 AATTAACTTCACAACTGAAGTGG + Intergenic
950456441 3:13095517-13095539 AAGCAACTCGGCCTCTGAGGAGG - Intergenic
954443759 3:50535723-50535745 AGGCAGCTTCAGCACTGAGGAGG - Intergenic
955520612 3:59772110-59772132 ACCCACCTCCACCACTGAGGGGG + Intronic
955708654 3:61755330-61755352 AAGGAACCACACCACTGAGGAGG + Intronic
955768493 3:62368666-62368688 ACGCAACCTCCCCATTGAGGGGG - Intergenic
958959416 3:100494868-100494890 AAGGAAACTCACCACAGAGGAGG - Intronic
964278573 3:155035939-155035961 AAGAAAATACACCACTCAGGAGG + Intronic
968664547 4:1813975-1813997 AGGCATCTTCAGCCCTGAGGAGG + Exonic
976163321 4:82227382-82227404 AAGCTGCTTCACCTGTGAGGAGG + Intergenic
983035371 4:162858468-162858490 AAGCAACGTGACTACAGAGGTGG - Intergenic
983357985 4:166689103-166689125 AAGCAACTCTTCCTCTGAGGAGG + Intergenic
985844493 5:2334328-2334350 CAGCAAGTTCACAACTGACGGGG + Intergenic
994926466 5:106122250-106122272 AAAAAACTTCACCAGAGAGGTGG - Intergenic
995900411 5:117059322-117059344 AAGCAACTGCCCCACAGAAGTGG - Intergenic
996354511 5:122581021-122581043 AAGCAACTTTACCTCTCAAGAGG - Intergenic
996661507 5:126009087-126009109 AACCAGCCTCCCCACTGAGGTGG + Intergenic
997269751 5:132526641-132526663 CAGGTACTTCACCTCTGAGGTGG + Intergenic
997490937 5:134275387-134275409 AGGCAAATTCACTGCTGAGGTGG - Intergenic
1000643646 5:163735319-163735341 AACCAACCTGCCCACTGAGGTGG - Intergenic
1002902268 6:1418997-1419019 AGCCAACTTTACCACTGCGGAGG + Intergenic
1004528372 6:16430168-16430190 ATGCCACTTCACCCCTGATGTGG - Intronic
1005890007 6:30129473-30129495 AAGCCACTTCTACACTGAGACGG + Intergenic
1008487080 6:52048023-52048045 AAGCAACGTGACCACAGAGGCGG + Intronic
1010832488 6:80547862-80547884 AAGCATCTTCATCAGTGAGTTGG + Intergenic
1012426906 6:99124741-99124763 AATTAACATCACCAATGAGGGGG + Intergenic
1015514861 6:134073640-134073662 AAGCAACTGCACCGTGGAGGAGG + Intergenic
1017414026 6:154200859-154200881 AAGCAACATCACCAATGATATGG + Intronic
1018229932 6:161665852-161665874 AGGCATCCTCACCACTGATGCGG + Intronic
1020646325 7:10818760-10818782 AAGCAGCTTCATCACAGAAGAGG + Intergenic
1020744421 7:12064232-12064254 AAGCTACTTGAGCACTGAGATGG - Intergenic
1021196551 7:17680233-17680255 AAGCAACGTCTCCGCTGAAGTGG - Intergenic
1021277372 7:18669860-18669882 AACCACCTTCACCAATGAGAAGG - Intronic
1022452678 7:30529538-30529560 AAGAAAATTCACCTCTGGGGTGG + Intronic
1023353543 7:39344282-39344304 AAGCAACTTCACCTCCGAGGAGG - Intronic
1024141079 7:46464033-46464055 CTGCAATTTTACCACTGAGGGGG + Intergenic
1025006263 7:55357738-55357760 AAGCATCCTCATCACTGATGGGG + Intergenic
1025188254 7:56877444-56877466 AAGCAGCTTCACCCCCGAGGAGG - Intergenic
1025683672 7:63699476-63699498 AAGCAGCTTCACCCCCGAGGAGG + Intergenic
1028115852 7:86996681-86996703 AAGTAACGACACCACTTAGGGGG + Intronic
1029533468 7:101141144-101141166 AAGCCCCCTCACCACAGAGGAGG + Intergenic
1031780135 7:125951607-125951629 TAGCAACTCCACTACTGATGTGG + Intergenic
1032202966 7:129836372-129836394 GAGCAAGGTCACCAATGAGGAGG + Intronic
1033577296 7:142697790-142697812 AAGCCATTGTACCACTGAGGAGG - Intergenic
1033643479 7:143284376-143284398 AAGCAGCATCACCTCGGAGGAGG + Intronic
1040888453 8:52290377-52290399 AAGCATCTTCACCTCTGAGCAGG - Intronic
1042160525 8:65889710-65889732 AAACACCTTCATCACTGATGTGG - Intergenic
1043622553 8:82213397-82213419 TAGCTACTTCACCACTGATAAGG - Intergenic
1049630028 8:143648839-143648861 AAGCAAGGTCACCAGTGGGGAGG + Intronic
1051370155 9:16352398-16352420 GAACAACTTCACCACCAAGGAGG - Intergenic
1051616662 9:19013273-19013295 AAAGATCTTCACCACTGCGGGGG + Intronic
1051783879 9:20721280-20721302 AAGTAGCTTCACCAAGGAGGAGG - Intronic
1052014293 9:23447121-23447143 AAGCAACTTACAGACTGAGGGGG - Intergenic
1052123017 9:24740121-24740143 AAGCCACTTCCCCACTGAAGTGG + Intergenic
1055562493 9:77534937-77534959 AAGCAACCTCACCAGTGAGCAGG + Intronic
1189589497 X:42496434-42496456 AAGCCAAGTCACCACTGAGTTGG + Intergenic
1190200482 X:48356567-48356589 TAGCAAATGCACCACGGAGGAGG + Intronic
1191771140 X:64759891-64759913 AAGCAACTTCACCAAAAAGTGGG - Intergenic
1193277303 X:79604554-79604576 AAGCACCTGCACCACTGGGCAGG + Intergenic
1193534843 X:82701227-82701249 AAGCTGCTTCACCACTTATGGGG + Intergenic
1198590923 X:138180487-138180509 AAGCAACTTCACCAATGCAATGG + Intergenic
1199807240 X:151312449-151312471 GAGCAACCTCAGCAATGAGGAGG + Intergenic
1200940113 Y:8772205-8772227 AAGCAACCTCAGCCCTGAGAAGG + Intergenic
1202365887 Y:24164461-24164483 AAGAAAATTCACCTCTGGGGTGG - Intergenic
1202374566 Y:24222119-24222141 AAGAAAATTCACCTCTGGGGTGG + Intergenic
1202496214 Y:25448001-25448023 AAGAAAATTCACCTCTGGGGTGG - Intergenic
1202504895 Y:25505661-25505683 AAGAAAATTCACCTCTGGGGTGG + Intergenic