ID: 1068002795

View in Genome Browser
Species Human (GRCh38)
Location 10:51356057-51356079
Sequence AAGGTGAATTCTATGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068002795_1068002800 -3 Left 1068002795 10:51356057-51356079 CCTCCCATCATAGAATTCACCTT 0: 1
1: 0
2: 0
3: 15
4: 147
Right 1068002800 10:51356077-51356099 CTTATTAGGCAAAAGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068002795 Original CRISPR AAGGTGAATTCTATGATGGG AGG (reversed) Intronic
902245553 1:15118307-15118329 AAGGTAAATCCTATGCTGGGAGG - Intergenic
903805288 1:26000935-26000957 AAGGGTAATTCTATGACTGGGGG + Intergenic
904898770 1:33839197-33839219 AAGGAGAATTCTAGGATGCTTGG + Intronic
907625631 1:56026578-56026600 AAGGTAAGTTCTATGAGGGCAGG + Intergenic
910847175 1:91614847-91614869 AAGGCAAACTCTAAGATGGGAGG - Intergenic
910923466 1:92374221-92374243 GAGGAGAATTCTAGGAAGGGAGG + Intronic
912219774 1:107660075-107660097 AAGGTGAATTAGATGATCCGTGG - Intronic
915296044 1:154922634-154922656 AAGGTAAATTCCGTGATGGCAGG + Intergenic
919124753 1:193380831-193380853 AGGGTGAATGCTATTATGGTGGG - Intergenic
919709383 1:200710855-200710877 GAGGGGAAATGTATGATGGGTGG + Intergenic
921749763 1:218778670-218778692 AAGCAGAATTCTATAATGGAGGG - Intergenic
922446898 1:225705473-225705495 AAGCTAAACTCTATGATGGGCGG - Intergenic
923335081 1:232961290-232961312 AAGGTGAAGTCTGAGATGGTGGG + Intronic
924371848 1:243359405-243359427 TGGGTGAATTCTATGGTGTGTGG + Intronic
1063201933 10:3792448-3792470 GTGGTGAATTGTATGATGTGAGG + Intergenic
1065124323 10:22559660-22559682 AAGGTGATTGCTATGATTGATGG - Intronic
1065826641 10:29578562-29578584 CAGGTGAATTCAATGTTGGTAGG - Intronic
1068002795 10:51356057-51356079 AAGGTGAATTCTATGATGGGAGG - Intronic
1068785261 10:60965796-60965818 AAAATGAATTCTAGGATGGATGG - Intronic
1070256034 10:74813770-74813792 AAGGTGAATTCTTTGAGGAAGGG + Intergenic
1073067895 10:100774672-100774694 AATGTGATTACTATGATGGTTGG - Intronic
1073835468 10:107436148-107436170 CTGATGAATTCTATGATGGCTGG - Intergenic
1074720240 10:116257568-116257590 AAGGTGCCTTCTATGATGAGAGG + Intronic
1075669170 10:124251734-124251756 AAGGTGTATTCTCTGCTTGGGGG - Intergenic
1083934969 11:65865363-65865385 AAGGTGAATTCCATGCATGGAGG - Intronic
1085142231 11:74156482-74156504 AAGGTGAATTTTATGGTATGTGG + Intronic
1088590926 11:111402491-111402513 AAAGTGAATTCTATGTCAGGAGG + Intronic
1091107401 11:132935742-132935764 AATGTGAATACAAGGATGGGAGG + Intronic
1091432095 12:445045-445067 AAGGTGAATTTTATGGTATGTGG + Intergenic
1094044765 12:26155276-26155298 AAGGTGAATTAGAAGATGAGAGG + Intronic
1098538237 12:71620432-71620454 AAGGTGAATAAGATGATGGATGG - Intronic
1099473818 12:83083533-83083555 AACATGAATTCTGTGATGGCAGG + Intronic
1101004678 12:100390310-100390332 AAGGTGAAATCTATGAGAGCAGG + Intronic
1101336433 12:103801126-103801148 AGGGTGAATTTTATGATGTTTGG - Intronic
1104357415 12:128100163-128100185 ACTGTGAATTTTATGATGGCAGG - Intergenic
1108321301 13:49293500-49293522 AAGGTGAAGTCTATGAGGGCAGG + Intergenic
1109994040 13:70099257-70099279 AATGTAAATTCTGTGATGGAGGG - Intronic
1110685350 13:78366223-78366245 AATGTGAAATCTATTATAGGAGG + Intergenic
1111639558 13:90949857-90949879 AAGGGGAATTCAATGAGAGGCGG + Intergenic
1112987529 13:105469763-105469785 AAGCTGAATTTTGTGATGTGTGG + Intronic
1117617540 14:57548762-57548784 AAGGAGAATCTTTTGATGGGAGG + Intergenic
1121616816 14:95319250-95319272 AAGGGGAATTGAATGGTGGGCGG - Intronic
1124593087 15:31070547-31070569 AAGGTCAACTCTATGTTCGGAGG - Intronic
1125139057 15:36382315-36382337 AATGTGAATTCTATCACAGGAGG - Intergenic
1130364033 15:83217242-83217264 CAGGAGAATTCTTTGTTGGGTGG - Intergenic
1135075279 16:19387839-19387861 AAGGTGAATACCAGGAGGGGAGG + Intergenic
1135821175 16:25687873-25687895 AAGGGGAATTCTAATATTGGAGG + Intergenic
1141199476 16:81886129-81886151 GTGGTGAATTCTAGGATGCGAGG - Intronic
1141641512 16:85344280-85344302 AGGGGGCATTTTATGATGGGAGG + Intergenic
1141995678 16:87635177-87635199 AAGGTGAACGCTTTGCTGGGAGG - Intronic
1143908112 17:10226041-10226063 AAGGTGCCTTCTATGAGGGATGG - Intergenic
1144370676 17:14588327-14588349 AATGTGTATTCTATTATGGTTGG - Intergenic
1150585517 17:66514362-66514384 AAGGAGAGTTCTCAGATGGGTGG - Intronic
1151421621 17:74001943-74001965 TAGGTGAATTGTATGTTGGAAGG + Intergenic
1152185537 17:78854446-78854468 AAGGTGAATTCTCAGATGATAGG - Exonic
1153832243 18:8934113-8934135 AAGGTGGCTTCAAAGATGGGAGG + Intergenic
1159995192 18:74957656-74957678 AAGGTGAGTTCTATTATGAGAGG + Intronic
1165224238 19:34342889-34342911 AAGCTGTATTCTATGAAGGCAGG - Intronic
1166346115 19:42167054-42167076 AAGGTGGATTCCACGATGGCAGG - Intronic
1166433902 19:42751067-42751089 ACAGTGAATTCCATGATGAGGGG + Intronic
1166437034 19:42776405-42776427 ATAGTGAATTCCATGATGAGGGG + Intronic
1166456167 19:42941805-42941827 ACAGTGAATTCCATGATGAGGGG + Intronic
1166485690 19:43210189-43210211 ACAGTGAATTCCATGATGAGGGG + Intergenic
1167381625 19:49141664-49141686 AATGGGAATTCAATGCTGGGAGG + Intronic
1167876348 19:52416630-52416652 AATGTGAATTCTATGGTGATTGG - Exonic
927601887 2:24450307-24450329 AATATGAATTCTGGGATGGGGGG - Intergenic
927630692 2:24771459-24771481 AAGGTGAATTTTAGAATGAGGGG + Intergenic
928027145 2:27749609-27749631 AAGGAGGATTCTTTGTTGGGTGG - Intergenic
932385300 2:71326861-71326883 AATGTAAATTCTATGAAGGCAGG + Intronic
932729812 2:74211347-74211369 CAGGCGAATTCTAAGATGAGGGG - Intronic
935629690 2:105203212-105203234 AAGGTGAATACCATCATGGCTGG - Intergenic
935793144 2:106612830-106612852 AATGGGAATGCTGTGATGGGAGG + Intergenic
936624087 2:114129217-114129239 AATGTAAATTCCCTGATGGGAGG + Intergenic
939634838 2:144569294-144569316 AAGTTGTATTCTATTTTGGGGGG + Intergenic
940091737 2:149927325-149927347 AAGGTGAATGCTATGTTGAATGG - Intergenic
945201897 2:207290098-207290120 AAGATAAATTTTATTATGGGGGG + Intergenic
946336006 2:219036996-219037018 AAGGTGACATGCATGATGGGAGG + Intronic
946829169 2:223710723-223710745 AAGGTAAATCCTTTGATGAGGGG - Intergenic
947391392 2:229643072-229643094 AAGGTGAATGCTATGATGCCTGG - Intronic
948550559 2:238769832-238769854 AAGGTGAAATGTACAATGGGTGG - Intergenic
948658903 2:239494645-239494667 AAGGGAAATTGTATGAAGGGTGG - Intergenic
1168952070 20:1809371-1809393 AAGTTGTATTCTGTGATGTGTGG + Intergenic
1172478776 20:35258766-35258788 CAGGTGAATTGTATAATGGTTGG - Intronic
1173868627 20:46328566-46328588 AAGGTGAATTCTATGGTTGACGG - Intergenic
1174440971 20:50553072-50553094 AAGGTAAATTCTATAAAGGAAGG + Intronic
1178134022 21:29605765-29605787 AAGGAAAATTCTAGGAAGGGAGG - Intronic
1180027877 21:45178610-45178632 AATGTGCATTCTAGGATGGGTGG + Intronic
1183175602 22:36222765-36222787 AAGGTGCCTTTTATGATGGAAGG + Intergenic
950665846 3:14494572-14494594 AGGGTCAATTCCAAGATGGGCGG + Intronic
950736376 3:15011996-15012018 AAGTTTAGTTCTATGATGGTGGG + Intronic
954252614 3:49379843-49379865 AAGGTGAATTGTAAGATATGTGG + Intronic
955984493 3:64558810-64558832 AAGGGGTATCCTATAATGGGGGG + Intronic
957282263 3:78168966-78168988 AAAGTGATTTCTATAATGGGTGG + Intergenic
957946928 3:87076044-87076066 AAAATTAATTCTATGGTGGGTGG - Intergenic
958059886 3:88466284-88466306 ATGGTAAATTCTCAGATGGGTGG - Intergenic
960653471 3:119978078-119978100 AAGGTGAATTTTAGAATGAGGGG - Intronic
960654699 3:119990012-119990034 AAGGTGAATTTTAGAATGAGGGG - Intronic
960750559 3:120947472-120947494 TAGGTGAATTGTATGGTGGGTGG - Intronic
964395891 3:156245166-156245188 AAGGTAAATTCTAAGATGGCAGG - Intronic
965645419 3:170875370-170875392 AAGGTGAAATATATGCGGGGAGG + Intergenic
966361873 3:179138281-179138303 AATGTACATTCTATGTTGGGTGG - Intergenic
970018405 4:11538925-11538947 AAGGTGAATTTTTTGGTTGGGGG + Intergenic
971134809 4:23856721-23856743 AAGGTAAATTCCATGAGGGAGGG - Intronic
973846272 4:54916173-54916195 AAGGTGAATTCTGTGGTGGCTGG - Intergenic
975112674 4:70644357-70644379 AAGGTGTATTCTTTGATTGAAGG - Exonic
975285695 4:72616713-72616735 TGGGTGAATTGTATGATGTGTGG + Intergenic
976056445 4:81074105-81074127 AAGATGAATCCCATGATGTGTGG + Intergenic
978141780 4:105326133-105326155 AAGGTGAACTCTACTATGTGAGG - Intergenic
979436871 4:120703522-120703544 AATGTGAGTTCTATGAGGGCAGG + Intronic
979687554 4:123527448-123527470 AAGGAAAATTCTAAAATGGGTGG - Intergenic
980890789 4:138812748-138812770 TAGGTGAATTGTATGATAAGTGG + Intergenic
983503382 4:168526108-168526130 AAGCTGAACTCTATGCTGGAAGG - Intronic
983722693 4:170876258-170876280 AAGGTAAATTTTATTCTGGGTGG + Intergenic
984142634 4:176022259-176022281 ACAGTGCAATCTATGATGGGAGG - Intergenic
986331979 5:6723921-6723943 AAGTTGCATTCTATGAAGAGTGG + Intronic
988576918 5:32435059-32435081 CAGGTGTATACCATGATGGGGGG + Intronic
989090784 5:37728466-37728488 AAGGTAACTGTTATGATGGGAGG - Intronic
990329888 5:54715062-54715084 AATGTGAGTTCTATGAGGGCAGG - Intergenic
990775129 5:59298018-59298040 GAGGTGATTTCTGTGAGGGGAGG + Intronic
990781527 5:59369797-59369819 CAGGTGAACTCTATAGTGGGTGG + Intronic
991276466 5:64853415-64853437 AATTTGCATTCTATGAAGGGGGG - Intronic
993354854 5:86893035-86893057 AAGTTCAATTCTATCATGGGTGG - Intergenic
996037085 5:118770444-118770466 AATTTGAATTCTATGAAGGTTGG + Intergenic
996458914 5:123718747-123718769 AATGTGAGATCTATGATGGCAGG + Intergenic
999055788 5:148574818-148574840 AAAATGAATTCTGTGGTGGGTGG - Intronic
999123415 5:149227929-149227951 AATGTAAATTCTATGAGGAGAGG - Intronic
999502990 5:152165323-152165345 AAGTAGATTTCTATTATGGGGGG + Intergenic
999586510 5:153095245-153095267 CAGGTGAATATAATGATGGGTGG + Intergenic
1002794713 6:463238-463260 AGGGTGAAGTTGATGATGGGTGG + Intergenic
1003346693 6:5275470-5275492 AATGTGAATTCTGTGAGGGCTGG + Intronic
1003440826 6:6139956-6139978 AAGGTGAATTAATTGATGGTTGG + Intergenic
1007431011 6:41777136-41777158 AATGTGAAGTCTTTGAGGGGGGG - Intronic
1012352720 6:98272621-98272643 AAGGTTAATTCCATGGTGTGTGG - Intergenic
1012625606 6:101400681-101400703 ATGGTGAATTTTATCATTGGGGG - Intronic
1013661584 6:112302913-112302935 AAGTTGAATTATATAATGTGTGG + Intergenic
1014282736 6:119459739-119459761 AAGGTGAATTCAAAGTTGAGTGG - Intergenic
1016755104 6:147676559-147676581 AAGGTGAATTCAACGAGGGTAGG + Intronic
1020924135 7:14302853-14302875 AATGTAAGATCTATGATGGGAGG + Intronic
1021990895 7:26140384-26140406 AATGTGAATTTGAGGATGGGAGG + Intergenic
1022433189 7:30348435-30348457 AGGGTAAATTCTATGAGGGCAGG - Intronic
1027753129 7:82177162-82177184 AAGGTGAATTCTGGGGTGGTAGG - Intronic
1033184023 7:139209186-139209208 AAAGAGAATTCAATCATGGGGGG + Intergenic
1034572721 7:151970113-151970135 AAACTGAATTCTTTGGTGGGTGG + Intronic
1035718933 8:1776322-1776344 AAGGTGAACTCTGTGAGGGTTGG + Intronic
1035718945 8:1776399-1776421 AAGGTGAAATCTGTGAGGGTTGG + Intronic
1038120222 8:24604820-24604842 AAAGTGAATTCTATGCCTGGTGG - Intergenic
1045475675 8:102550308-102550330 AAGGTGAGTGGGATGATGGGTGG + Intergenic
1046549377 8:115694587-115694609 AATGTAAATTCTATGATGAAAGG - Intronic
1050135275 9:2456758-2456780 AAGGTTAATGCCATGATGGGAGG - Intergenic
1051588462 9:18751526-18751548 AAGGTGCCCTCTATGATGGGAGG + Intronic
1052405459 9:28054078-28054100 AAGTGGGATTCTGTGATGGGAGG + Intronic
1056719705 9:89061149-89061171 GAGGTGAATTTTCTGATGGTTGG - Intronic
1061530348 9:131206937-131206959 AAGGTTTTTTCTATGATGGCAGG + Intronic
1061809429 9:133153835-133153857 AAGGGGACTTCTATTATGGTGGG - Exonic
1188987710 X:36782322-36782344 ATGGTGAATTTTATGATATGTGG + Intergenic
1191741476 X:64439758-64439780 AAGGTCAGTTCTATAAGGGGTGG + Intergenic
1191810702 X:65184492-65184514 AAGGTGGATTTTGTGATGGATGG + Intergenic
1192908145 X:75573599-75573621 AAAATGACTTCAATGATGGGTGG + Intergenic
1193841538 X:86413702-86413724 AGGGTGAGGTCTATGATGGTGGG - Intronic
1194640624 X:96399678-96399700 ATGGTCAGTTCTATGAAGGGAGG - Intergenic
1196997359 X:121399084-121399106 AAATTGAATTATATGATGTGTGG - Intergenic
1200732904 Y:6761526-6761548 AAGGGGAATTGTGTCATGGGAGG + Intergenic
1201635052 Y:16113267-16113289 AAGGTGAATTTTAGAATGAGGGG + Intergenic