ID: 1068003418

View in Genome Browser
Species Human (GRCh38)
Location 10:51364077-51364099
Sequence ATCTAATTCTTGTGCTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 85, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068003418_1068003422 14 Left 1068003418 10:51364077-51364099 CCTTCTTAGCACAAGAATTAGAT 0: 1
1: 0
2: 3
3: 85
4: 169
Right 1068003422 10:51364114-51364136 TTTTTTATTAGATGGCTAAGGGG No data
1068003418_1068003420 12 Left 1068003418 10:51364077-51364099 CCTTCTTAGCACAAGAATTAGAT 0: 1
1: 0
2: 3
3: 85
4: 169
Right 1068003420 10:51364112-51364134 AGTTTTTTATTAGATGGCTAAGG No data
1068003418_1068003421 13 Left 1068003418 10:51364077-51364099 CCTTCTTAGCACAAGAATTAGAT 0: 1
1: 0
2: 3
3: 85
4: 169
Right 1068003421 10:51364113-51364135 GTTTTTTATTAGATGGCTAAGGG No data
1068003418_1068003419 6 Left 1068003418 10:51364077-51364099 CCTTCTTAGCACAAGAATTAGAT 0: 1
1: 0
2: 3
3: 85
4: 169
Right 1068003419 10:51364106-51364128 CACTGCAGTTTTTTATTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068003418 Original CRISPR ATCTAATTCTTGTGCTAAGA AGG (reversed) Intronic
900202337 1:1415173-1415195 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
902986554 1:20157900-20157922 ATCTGCTTCTTGTGCTAGCAGGG - Intergenic
904617950 1:31760142-31760164 ATCTAACTCTTGTGCAGGGATGG - Intronic
906499172 1:46328522-46328544 ATTTGCTTCTTGTGCTAACAGGG + Intergenic
909776822 1:79492817-79492839 AAATAATTCTTGTTGTAAGATGG - Intergenic
910852813 1:91665399-91665421 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
912816180 1:112830460-112830482 ATCCACTTCTTGTGCTAGCAGGG - Intergenic
913220378 1:116655243-116655265 TTCTAATACTTTTCCTAAGAAGG - Intronic
916601190 1:166295087-166295109 ATATAATTTCTGTACTAAGAAGG + Intergenic
916766611 1:167866916-167866938 ATCTGCTTCTTGTGCTAACAGGG - Intronic
917115967 1:171603838-171603860 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
917908264 1:179611881-179611903 ATTTAAATCTTGTTCTGAGAGGG + Intronic
918647267 1:186918903-186918925 ATCTGCTTCTTGTGCTAACAGGG + Intronic
919534799 1:198774227-198774249 ATCTACTTTGTGTGCTAAGAAGG + Intergenic
920450321 1:206055925-206055947 ATCTGCTTCTTGTGCTAACAGGG - Intronic
921074786 1:211691625-211691647 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
921932602 1:220767057-220767079 ATTTTATTCCTGTGCTATGATGG + Intronic
922680608 1:227592328-227592350 ATCTGCTTCTTGTGCTAACAGGG + Intronic
922690306 1:227683775-227683797 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
924858926 1:247901272-247901294 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
924928663 1:248707838-248707860 TTCTTATTCTTGATCTAAGATGG + Intergenic
1065802268 10:29363399-29363421 ATTTGCTTCTTGTGCTAACAGGG + Intergenic
1065931170 10:30480261-30480283 ATCTGTTTCTTATGCTAACAGGG - Intergenic
1065994060 10:31040112-31040134 ATCTAATTCTTCTGTTATTATGG + Intergenic
1068003418 10:51364077-51364099 ATCTAATTCTTGTGCTAAGAAGG - Intronic
1068675644 10:59766893-59766915 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1071282158 10:84112652-84112674 ATCTGCTTCTTGTGGTAACAGGG - Intergenic
1072284802 10:93904204-93904226 TGCTAAGTCTTGGGCTAAGATGG - Intronic
1072334957 10:94389649-94389671 TTCTGCTTCTTGTGCTAACAGGG - Intergenic
1072689037 10:97558420-97558442 ATCTGCTTCTTGTGCTAACAGGG + Intronic
1073154910 10:101338680-101338702 AACTAATTATTGTGTTATGAGGG - Intergenic
1073836769 10:107453285-107453307 ATCTCATCCTTTTGCTAAGATGG + Intergenic
1073914430 10:108385815-108385837 GTCTAGTTCTTTTGCCAAGATGG - Intergenic
1074504478 10:114056474-114056496 CTCTAGCTTTTGTGCTAAGATGG - Intergenic
1074720527 10:116260728-116260750 TTCTAATTAATGTTCTAAGAGGG - Intronic
1076190310 10:128478661-128478683 ATCTCATTCTTGTGCTCGGCTGG + Intergenic
1078385898 11:10892393-10892415 ATATAATTCACTTGCTAAGAAGG - Intergenic
1078513021 11:11999887-11999909 ATCAAATTCTAGTTCTGAGAAGG + Intronic
1079218378 11:18536459-18536481 ATCTAATTTTAGTGCTCACATGG - Exonic
1080939873 11:36903506-36903528 ATTTATTTCTTGTTCTAAAAAGG + Intergenic
1081559300 11:44198158-44198180 ATCTCATTCTTGTTCTAGGGTGG + Intronic
1083082075 11:60104316-60104338 ATTTGCTTCTTGTGCTAACAGGG + Intergenic
1083090033 11:60190229-60190251 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1085998893 11:81955011-81955033 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1086604276 11:88676854-88676876 ATTTAATGCTTGTGCTCAAATGG + Intronic
1086954136 11:92918121-92918143 ATCTAATTCTTATGCTAAGCAGG - Intergenic
1086973307 11:93106459-93106481 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1087684662 11:101249336-101249358 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1092583119 12:9869064-9869086 ATCTCAATCTTGTTATAAGAAGG + Intronic
1093593968 12:20939993-20940015 ATCTACTTCTTGTGCTAACAGGG + Intergenic
1093908108 12:24715528-24715550 ATATAATTCTTGTGCCACAACGG + Intergenic
1096207874 12:49738543-49738565 ATCTGCTTCTTGTGCTAACAGGG - Intronic
1098248540 12:68545010-68545032 ATCTGCTCCTTGTGCTAACAGGG - Intergenic
1098639396 12:72821218-72821240 ATCTGCTTCTTGTGCTAATAGGG + Intergenic
1099892880 12:88611121-88611143 AACTCATTCATGTGCTAAGGAGG + Intergenic
1101029320 12:100644424-100644446 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1103629114 12:122245385-122245407 TTCTAATTCTTGTTCTAGGATGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105695751 13:22886878-22886900 ATCTGCTTCTTATGCTAACAGGG - Intergenic
1107490589 13:40877180-40877202 ATCTGCTTCTTGTGCTAGCAGGG + Intergenic
1108542705 13:51458763-51458785 ATCTGATTATTCTGCTCAGATGG - Intergenic
1109802934 13:67401393-67401415 ATCTGCTTCTTGTGCTAATAGGG - Intergenic
1110653566 13:77971360-77971382 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1111679254 13:91424279-91424301 AAGTCATTCTTGTCCTAAGAAGG - Intronic
1115890433 14:38021212-38021234 ATAAAATTTTTGTGTTAAGAAGG + Intronic
1116565053 14:46433924-46433946 ACCAACTTCTTATGCTAAGAGGG + Intergenic
1118703622 14:68459978-68460000 CTCTAATTCCTGTGCCAGGAAGG - Intronic
1119970384 14:78963755-78963777 ATCTAATTTTTGTGCTTATAGGG + Intronic
1121896598 14:97654090-97654112 ATATAATTCTTGTGATCAAAAGG - Intergenic
1122380347 14:101299522-101299544 ATTTAATTTTTGTTCTGAGACGG - Intergenic
1125045654 15:35240241-35240263 AAATAATTCTTGTCCTAAAATGG + Intronic
1127096377 15:55515640-55515662 ATCTCCTTCTTGTGCTAACAGGG + Intergenic
1127459376 15:59184011-59184033 ATCTCATTCTTTTTCTGAGACGG + Intronic
1133105062 16:3502100-3502122 CTCGAATTCCTTTGCTAAGAGGG + Intronic
1133651272 16:7816159-7816181 ATATAATTCTTGTCGTAAAATGG + Intergenic
1135895549 16:26398256-26398278 CTCTAATTATTGTATTAAGAAGG + Intergenic
1140926234 16:79586895-79586917 ATCTAATTCTTTTTCCAACATGG + Intronic
1144104555 17:11973391-11973413 AACTAATTCTTGTCGTAAAATGG + Intergenic
1144413719 17:15025333-15025355 TTCTATTTCTTTTGCAAAGAGGG + Intergenic
1147810164 17:43163143-43163165 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1148283059 17:46363893-46363915 ACCTCATTCTTGTGCTGAGTGGG - Intergenic
1148305276 17:46581818-46581840 ACCTCATTCTTGTGCTGAGTGGG - Intergenic
1148828813 17:50415657-50415679 ATCTGCTTCTTGTGCTAACACGG + Intergenic
1149076058 17:52596964-52596986 ATCCACTTCTTGTGCTAGCAGGG - Intergenic
1152455102 17:80410556-80410578 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1153668891 18:7391779-7391801 ATCTAATTTTTTTTTTAAGATGG + Intergenic
1153830531 18:8918392-8918414 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1154013992 18:10600326-10600348 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1157015694 18:43710212-43710234 ATATAATTCCTGTGCCAAAAAGG - Intergenic
1158292166 18:55954614-55954636 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1159516268 18:69462411-69462433 AACTATTCCTTGTGCTATGAAGG + Intronic
1162282045 19:9706600-9706622 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1162284278 19:9726670-9726692 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1162395990 19:10418388-10418410 AGCTCATTCTTGAGCCAAGAGGG - Intronic
1162468065 19:10854674-10854696 AGCGAAGTCTTGTGCTGAGAAGG + Intronic
1163916723 19:20246553-20246575 ATCTGTTTCTTGTGCTAGCAGGG - Intergenic
1163934396 19:20429056-20429078 ATCTGCTTCTTGTGGTAACAGGG + Intergenic
1163943280 19:20514377-20514399 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1164216810 19:23157793-23157815 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1167935333 19:52901769-52901791 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
925985192 2:9209152-9209174 AACCAATTCTTGGGCTTAGACGG - Intronic
926491301 2:13528909-13528931 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
926564752 2:14456717-14456739 ATCTAATTGTTGTGCTGTGGAGG + Intergenic
926956772 2:18310389-18310411 ATCAAATTCTTGTGTTTGGAGGG - Intronic
931698458 2:64889769-64889791 ATCCACTTCTTGTGCTAGCAGGG + Intergenic
933319253 2:80752451-80752473 AACTAAAGCTTGTGCTAACAGGG - Intergenic
935462281 2:103352435-103352457 ATCTAAATATTTTGCTAAGTGGG - Intergenic
935970731 2:108528508-108528530 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
936811786 2:116411793-116411815 ATCAAATTCTGGTGCTTGGAAGG + Intergenic
938823937 2:134985854-134985876 ACCTAAATCTTGTCCTCAGATGG - Exonic
941028929 2:160490738-160490760 ATCTAATTCTTTTAATCAGAAGG - Intronic
943883969 2:193187163-193187185 ATCTAATTCTCCTGAGAAGAGGG + Intergenic
945289894 2:208116568-208116590 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
945373727 2:209053943-209053965 TTCTATTTCTTGAGCTAGGAGGG - Intergenic
1170400961 20:15982851-15982873 ATCTGCTTCTTGTGCTAACAGGG + Intronic
1170495238 20:16917130-16917152 ATCTCATTCTGTTGCTAAGTTGG + Intergenic
1171891367 20:30720057-30720079 ATCTATTTCTTGGTCTAATACGG - Intronic
1175513744 20:59554518-59554540 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1176868354 21:14068887-14068909 ATCTATTTCTTGGTCTAATACGG + Intergenic
1178447646 21:32660239-32660261 ATCTGCTTCTTGTGCTAACAGGG - Intronic
1179669208 21:42933829-42933851 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1179670741 21:42945718-42945740 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
949532829 3:4974401-4974423 TTCTAATACATGTGCTAATATGG + Intergenic
950337603 3:12210255-12210277 ATCTAATTCAGGTGCTAAATCGG + Intergenic
951166075 3:19486439-19486461 ATCTGCTTCTTGTGCTAACAGGG + Intronic
951443910 3:22754657-22754679 ATTTAATCCTTGTAATAAGATGG + Intergenic
951512155 3:23514496-23514518 ATCTAATTCTTATACCCAGAAGG + Intronic
954962727 3:54580494-54580516 AGCTAACTCTTGAGCAAAGAGGG - Intronic
957999762 3:87736515-87736537 ATCTGCTTCTTGTGCTAATGGGG + Intergenic
959989997 3:112620962-112620984 GTCTAATTCTGGTTCTAAGTAGG - Intronic
960022240 3:112967815-112967837 CTCTAATTTTTGTACTATGAAGG + Intronic
962096598 3:132299026-132299048 ATCTGCTTCTTGAGCTAACAGGG + Intergenic
963566329 3:146935580-146935602 AGCTTATTCTTGTTCTTAGAAGG + Intergenic
964522471 3:157583745-157583767 ATCTGCTTCTTGTGCTAACAGGG + Intronic
965287480 3:166835286-166835308 ATCTTATACTTGTTTTAAGATGG - Intergenic
965640172 3:170822240-170822262 AAATAATTCTTGTCCTAAAATGG - Intronic
966279176 3:178208977-178208999 ATCTAAATCTTGTTGTAAAAGGG + Intergenic
966786311 3:183625880-183625902 ATTTAATTCTTATAATAAGAAGG + Intergenic
969748934 4:9095705-9095727 AGATAATTCTTGTCATAAGATGG + Intergenic
970367808 4:15378130-15378152 AGCTAATTCTTTAGCTAACATGG + Intronic
972077410 4:35104698-35104720 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
972217196 4:36910418-36910440 ATCTGCTTCTTATGCTAACAGGG - Intergenic
972275062 4:37549479-37549501 ATCTGCTTCTTGTGCTAACAGGG - Intronic
972281613 4:37607040-37607062 AGCTGATTCTTGTGATTAGACGG - Intronic
972549801 4:40120772-40120794 ATCTGATTCTTTAGCTCAGAGGG + Exonic
973839767 4:54849475-54849497 ATCTAATTCTTTCTCTAAAATGG - Intergenic
974338364 4:60581114-60581136 ATCTAAATTTTGTGCTAACTTGG - Intergenic
974988101 4:69054354-69054376 ATCTGCTTCTTGTGGTAACAGGG - Intronic
975205800 4:71643022-71643044 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
975681906 4:76885718-76885740 ATCAAATTTTTGTTCTAACAAGG + Intergenic
976033866 4:80792955-80792977 ATCTATTTCTTGTGCAACAATGG + Intronic
977043414 4:92041353-92041375 ATCTGCTTCTTATGCTAACAGGG + Intergenic
977968050 4:103178403-103178425 GTTTAATTCTTCTGCTGAGATGG - Intronic
977972530 4:103228494-103228516 ATCTGCTGCTTGTGCTAACAGGG - Intergenic
979052598 4:115953545-115953567 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
979386920 4:120077763-120077785 ATCTAACTCTTGAGCTAATGAGG - Intergenic
979391471 4:120133108-120133130 ATGTAATTCTCCTGCTTAGAAGG - Intergenic
979924055 4:126537668-126537690 AACCAACTCTTGTGCTAAAATGG + Intergenic
980259266 4:130426526-130426548 ATCTAAATCATGTTCAAAGAGGG - Intergenic
980780076 4:137482509-137482531 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
982662620 4:158225135-158225157 ATCTGCTTCTTGTGCTAACAGGG + Intronic
983024365 4:162714830-162714852 ATATAACTCTTGTGAAAAGATGG + Intergenic
983898117 4:173103291-173103313 ATCTGCTTCTTGTGCTAACAAGG - Intergenic
984096308 4:175439280-175439302 CTCTACTTCTTGGGCTCAGATGG + Intergenic
984282543 4:177689281-177689303 CTCCAATTCTTGCTCTAAGATGG + Intergenic
984291273 4:177797838-177797860 ATGTAATTCTTTTGCAAAGACGG - Intronic
986083071 5:4414222-4414244 ATCTAATTTGTGTACTTAGAAGG + Intergenic
987471638 5:18338105-18338127 ATCTATTTCTCATGCTCAGAGGG - Intergenic
988124324 5:27009497-27009519 ATTCAATTTTTCTGCTAAGAGGG + Intronic
989095896 5:37781023-37781045 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
989557735 5:42816811-42816833 ATCTGCTTCTTGTGCTAACAGGG - Intronic
990718025 5:58660580-58660602 ATCTGATTCATGTGATAAAATGG - Intronic
992989549 5:82270224-82270246 ATCTGCTTCTTGTGCTAACAGGG + Intronic
993320406 5:86462826-86462848 ATCTGCTTCTTGTGCTAGCAGGG - Intergenic
993832444 5:92776905-92776927 ATCTCCTTCTTCTTCTAAGAAGG + Intergenic
995176260 5:109181350-109181372 ATATAAATCTTGAGCAAAGAAGG + Intronic
995473762 5:112528108-112528130 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
995867567 5:116707737-116707759 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
997995494 5:138582576-138582598 CTCTAATTCTTGTGCTGCAATGG + Intergenic
998114846 5:139528557-139528579 ATTTGCTTCTTGTGCTAACAGGG - Intronic
999008819 5:148012030-148012052 ATCAAATTTCTGTGGTAAGAAGG + Intergenic
999398492 5:151246471-151246493 ATCTAATCCTTGTACTTTGATGG + Intronic
1000236973 5:159370917-159370939 ATCTGCTTCTTGTGCTAACATGG - Intergenic
1000371234 5:160538606-160538628 ATGTCAATCTTGTGCTCAGAGGG - Intergenic
1000522137 5:162308427-162308449 ACATAATACTTGTGCCAAGATGG + Intergenic
1000604748 5:163316007-163316029 ATCTGCTTCTTGTGTTAACAGGG + Intergenic
1002408208 5:179052976-179052998 GTCTGCTTCTTGTGCTAACAGGG + Intergenic
1002998963 6:2313344-2313366 ATCTGCTTCTTGCGCTAACAGGG + Intergenic
1006032028 6:31183399-31183421 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1006570757 6:35001964-35001986 ATCTGCTTCTTGTGCTAACAGGG - Intronic
1007612988 6:43162277-43162299 GCCTAATCCTTGTGCTCAGATGG + Intergenic
1008123624 6:47645210-47645232 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1009547502 6:65039746-65039768 ACCTAAGTCTTATGCTATGATGG + Intronic
1010317907 6:74471653-74471675 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1010605321 6:77882569-77882591 AGCTAATTCTGATGGTAAGAAGG - Intronic
1010760329 6:79715039-79715061 ATATAATGCTTGTGGTAAGTGGG - Intergenic
1012611763 6:101227687-101227709 ATCTGCTTCTTATGCTAACAGGG + Intergenic
1012905832 6:105064470-105064492 ATCTGATTCTGATTCTAAGAGGG - Intronic
1012959708 6:105609586-105609608 ATCTACCTCTGGTGCTAAGGGGG - Intergenic
1013559152 6:111287134-111287156 ATCTGCTTTTTGTGCTAACAGGG + Intergenic
1014259052 6:119195188-119195210 ATCTCATTCATGTATTAAGAGGG - Intronic
1015172074 6:130264991-130265013 ATCTGCTTCTTGTGCTAACAAGG - Intronic
1015915051 6:138207678-138207700 ATCTAATTCTGATGGTAAAAAGG + Intronic
1017869207 6:158472043-158472065 ATCCAATTCCTGAGCTAAAACGG - Intronic
1018041955 6:159932607-159932629 AGGTTATTCTTGAGCTAAGAAGG + Intergenic
1020043746 7:5024129-5024151 ATCTGCTTCTTGTGCTAACAGGG + Intronic
1024171998 7:46798562-46798584 ATCTATTTTTTGTGTTAGGATGG + Intergenic
1024213491 7:47227383-47227405 AGCTCATGCTTGTGCCAAGATGG + Intergenic
1029486241 7:100843636-100843658 ATCTGCTTCTTGTGCTAACAGGG - Intronic
1030061604 7:105625799-105625821 ATCTAACTCTTCTGCTAATGCGG - Intronic
1032170698 7:129582289-129582311 ATCTGCTTCTTGTGCTAGCAGGG - Intergenic
1032979424 7:137264828-137264850 ATCTGCTTCTTGTGCTAACAGGG + Intronic
1038089807 8:24240362-24240384 ATCTGCTTCTTGTGCTAACAAGG - Intergenic
1038957668 8:32484970-32484992 AGAGAATTCTTGTGCAAAGAAGG + Intronic
1040663766 8:49605376-49605398 ATCTAGACCTTGTGCTAAAAAGG + Intergenic
1040754617 8:50757818-50757840 ATATAACTGTTGTGCTAATAAGG - Intronic
1041227283 8:55713090-55713112 ATCTGCTTCTTGTGCAAACAGGG - Intronic
1041515613 8:58695898-58695920 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1046456740 8:114475114-114475136 ATCTCACTGTTGTGCTAGGAAGG + Intergenic
1047007407 8:120634764-120634786 ACTTAATGCTTGTGGTAAGACGG - Intronic
1049634031 8:143676483-143676505 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1050861403 9:10437049-10437071 GTCAAGTTGTTGTGCTAAGAAGG - Intronic
1052508241 9:29381945-29381967 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1055438065 9:76312187-76312209 ATCAAATTCTTTTAATAAGAGGG - Intronic
1058256086 9:102765657-102765679 CTCTATTTCTTGTAGTAAGATGG - Intergenic
1058636329 9:107041995-107042017 TTCTCATTCTTATCCTAAGAGGG + Intergenic
1059090523 9:111352743-111352765 ATCTCATTCCTGAGCTTAGAGGG + Intergenic
1186558574 X:10586704-10586726 ATCTGCTTCTTGTGCTAACAGGG + Intronic
1187164688 X:16794031-16794053 ATCTACTTATGGCGCTAAGAAGG + Intronic
1188543123 X:31271287-31271309 ATCTGAGTCTTGAGCTCAGAGGG + Intronic
1189428965 X:40930509-40930531 ATCTAATTGTTTTTCTGAGAAGG - Intergenic
1190270418 X:48858829-48858851 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1190425914 X:50334491-50334513 ATCTGCTTCTTGTGCTAACAGGG + Intronic
1190771377 X:53517497-53517519 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1191036105 X:56027980-56028002 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1191639375 X:63413755-63413777 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1191917819 X:66221498-66221520 GTCTGCTTCTTGTGCTAACAGGG + Intronic
1192915317 X:75645626-75645648 ATCTACTTCTTGTGCTAACAGGG + Intergenic
1193717484 X:84949510-84949532 ATCTGCTTCTTGTGCTAACAGGG - Intergenic
1193904993 X:87231389-87231411 AACAAATTCTTATTCTAAGATGG + Intergenic
1193922132 X:87442270-87442292 ATATAATTCATATGCTAAGAGGG - Intergenic
1194556479 X:95367156-95367178 AGTTGATTCTTGTGCTAAGTAGG - Intergenic
1195958280 X:110358041-110358063 ATATAATTCTTCTGATAAAATGG - Intronic
1196422860 X:115540675-115540697 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1196459927 X:115919380-115919402 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1196869557 X:120099800-120099822 ATCCACTTCTTGTGCTAGTAGGG - Intergenic
1196938661 X:120754183-120754205 AAATAATTATTGAGCTAAGAAGG + Intergenic
1196993141 X:121349800-121349822 ACCCAATTCTTGTGCTCTGAAGG - Intergenic
1198417872 X:136439174-136439196 ATATAATTTATGTGCTATGAAGG + Intergenic
1199278680 X:145974631-145974653 ATCTTGTTCTTGTGGTTAGATGG - Intergenic
1200394147 X:155973458-155973480 ATCTGCTTCTTGTGCTCACAGGG + Intergenic
1200622850 Y:5475238-5475260 ATCTTATTCTTGATCTCAGAGGG + Intronic
1200699179 Y:6387469-6387491 ATCCACTTCTTGTGCTAGCAGGG - Intergenic
1200943323 Y:8807188-8807210 ATTTGCTTCTTGTGCTAACAGGG - Intergenic
1201034932 Y:9777229-9777251 ATCCACTTCTTGTGCTAGCAGGG + Intergenic
1201259948 Y:12149156-12149178 ATCTGCTTCTTGTGCTAACAGGG + Intergenic
1201270292 Y:12247456-12247478 TTCTACTTCTTGTGCTAACAGGG - Intergenic
1201680577 Y:16640609-16640631 TTCTGCTTCTTGTGCTAACAGGG + Intergenic