ID: 1068007717

View in Genome Browser
Species Human (GRCh38)
Location 10:51409826-51409848
Sequence CAGAGTCTCTCTCTGTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31256
Summary {0: 45, 1: 1231, 2: 4295, 3: 10323, 4: 15362}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068007717_1068007718 1 Left 1068007717 10:51409826-51409848 CCTGGCAACAGAGAGAGACTCTG 0: 45
1: 1231
2: 4295
3: 10323
4: 15362
Right 1068007718 10:51409850-51409872 CAAAAAAAAAAAAAAAAAAAAGG 0: 2741
1: 26101
2: 29291
3: 53890
4: 110889
1068007717_1068007719 29 Left 1068007717 10:51409826-51409848 CCTGGCAACAGAGAGAGACTCTG 0: 45
1: 1231
2: 4295
3: 10323
4: 15362
Right 1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG No data
1068007717_1068007720 30 Left 1068007717 10:51409826-51409848 CCTGGCAACAGAGAGAGACTCTG 0: 45
1: 1231
2: 4295
3: 10323
4: 15362
Right 1068007720 10:51409879-51409901 GTTATCTGCAGAAGATGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068007717 Original CRISPR CAGAGTCTCTCTCTGTTGCC AGG (reversed) Intronic
Too many off-targets to display for this crispr