ID: 1068007719 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:51409878-51409900 |
Sequence | AGTTATCTGCAGAAGATGTC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1068007717_1068007719 | 29 | Left | 1068007717 | 10:51409826-51409848 | CCTGGCAACAGAGAGAGACTCTG | 0: 45 1: 1231 2: 4295 3: 10323 4: 15362 |
||
Right | 1068007719 | 10:51409878-51409900 | AGTTATCTGCAGAAGATGTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1068007719 | Original CRISPR | AGTTATCTGCAGAAGATGTC AGG | Intronic | ||
No off target data available for this crispr |