ID: 1068007719

View in Genome Browser
Species Human (GRCh38)
Location 10:51409878-51409900
Sequence AGTTATCTGCAGAAGATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068007717_1068007719 29 Left 1068007717 10:51409826-51409848 CCTGGCAACAGAGAGAGACTCTG 0: 45
1: 1231
2: 4295
3: 10323
4: 15362
Right 1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068007719 Original CRISPR AGTTATCTGCAGAAGATGTC AGG Intronic
No off target data available for this crispr