ID: 1068008838

View in Genome Browser
Species Human (GRCh38)
Location 10:51422326-51422348
Sequence CACCTAGCTGTGGCATCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068008838_1068008841 2 Left 1068008838 10:51422326-51422348 CCATAGGATGCCACAGCTAGGTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1068008841 10:51422351-51422373 TCCTAGACGTTTAGCATGATGGG No data
1068008838_1068008840 1 Left 1068008838 10:51422326-51422348 CCATAGGATGCCACAGCTAGGTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1068008840 10:51422350-51422372 GTCCTAGACGTTTAGCATGATGG No data
1068008838_1068008844 14 Left 1068008838 10:51422326-51422348 CCATAGGATGCCACAGCTAGGTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1068008844 10:51422363-51422385 AGCATGATGGGTAGTACAGAGGG No data
1068008838_1068008843 13 Left 1068008838 10:51422326-51422348 CCATAGGATGCCACAGCTAGGTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1068008843 10:51422362-51422384 TAGCATGATGGGTAGTACAGAGG No data
1068008838_1068008845 15 Left 1068008838 10:51422326-51422348 CCATAGGATGCCACAGCTAGGTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1068008845 10:51422364-51422386 GCATGATGGGTAGTACAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068008838 Original CRISPR CACCTAGCTGTGGCATCCTA TGG (reversed) Intronic
900391807 1:2436916-2436938 CACCCAGCTGAGGCCTCCTGGGG + Intronic
900483133 1:2909011-2909033 CACCCAGCTCTGGCTTCCAAGGG + Intergenic
900551040 1:3255701-3255723 CAGATAGCTCTGGCATCCAAGGG - Intronic
901052570 1:6432627-6432649 CACACTGCTGGGGCATCCTAGGG + Intronic
903920957 1:26800333-26800355 CACCTAGCTGTGGCATTGTTAGG - Intergenic
905279716 1:36841372-36841394 CCCATAGCTGGGGCATCCTCTGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
908199645 1:61781085-61781107 CACCTAGCTGCTGTAACCTAGGG - Intronic
1064904338 10:20329505-20329527 CTTCTTGCTGTGTCATCCTATGG - Intergenic
1065567174 10:27024058-27024080 AACCTATCTGTGTCATCCTTTGG - Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068657549 10:59591066-59591088 CACCTTGCTGTGGCTGCTTAAGG - Intergenic
1073065205 10:100754522-100754544 CTCCTAGCAGTGGCAACCCAGGG + Intronic
1074180872 10:111061583-111061605 TGCCTATCAGTGGCATCCTACGG + Intergenic
1079556298 11:21761798-21761820 CTTCTTGCTGTGTCATCCTATGG + Intergenic
1082260303 11:50072846-50072868 TGCCTCGCTGTGGCATCCTCGGG - Intergenic
1083587647 11:63872178-63872200 CACCTCTCTGTGGCAGCCTTGGG + Intronic
1083820741 11:65170075-65170097 CACCCAGCTGTGGCTCCCCAGGG - Intergenic
1090401075 11:126448666-126448688 CTTCTTGCTGTGGCATCCCATGG - Intronic
1091858244 12:3756107-3756129 GACCTAGCAGTGGCCTCTTAGGG - Intronic
1092273434 12:7041074-7041096 TACATAGTGGTGGCATCCTAGGG + Intronic
1093071597 12:14711178-14711200 AACCACGCTTTGGCATCCTAGGG - Intergenic
1095511852 12:42959574-42959596 CATCTAGCTGTGTCCTCCCAGGG - Intergenic
1096396342 12:51269668-51269690 CTCCTAGCTGTGGAACCCTAGGG - Intronic
1104262905 12:127201066-127201088 CTCCTTGTTGTGGCATCCTGGGG + Intergenic
1108372697 13:49786769-49786791 CAACTATGTGTGGCATGCTAAGG + Intronic
1110564695 13:76946513-76946535 CACCAAATTGTGGCATCTTATGG - Intergenic
1112558913 13:100494336-100494358 GACCTAGCCATGGCATCCGAAGG - Intronic
1118788150 14:69064083-69064105 CCCCTAGCACTGGCTTCCTAAGG + Intronic
1121714820 14:96066052-96066074 CACGTGGCTGTGGCTTCCTGAGG - Intronic
1126591063 15:50340138-50340160 CACCTTGCTGTGCCCTCATATGG - Intronic
1126782507 15:52150681-52150703 AACCCAGCTGTGGCCTCCCATGG + Intronic
1134692569 16:16200604-16200626 CACCTAGCTCTGGCATGCTCAGG + Intronic
1134979273 16:18594072-18594094 CACCCAGCTCTGGCATGCTCAGG - Intergenic
1136124071 16:28163807-28163829 CACCTAGATTTGGAATTCTAGGG + Intronic
1138903690 16:61304626-61304648 CTCCTAGCTGTGGGAACATATGG - Intergenic
1139646388 16:68334154-68334176 CACCCAGCTGAGGCATCCTGAGG + Intronic
1140355898 16:74306202-74306224 CCCATAGCTCTGGCATCCTCAGG + Exonic
1144424610 17:15130164-15130186 CACCAGGCTTTGGCATCCAATGG + Intergenic
1148822114 17:50365806-50365828 GACCTCGGTGTGGCATCCCATGG - Intergenic
1150981011 17:70141614-70141636 CTCCTAGTTGTGTCATCCCATGG + Intergenic
1155744152 18:29330511-29330533 CACATAGCTGTAGCTTCCTAGGG - Intergenic
1156836719 18:41563774-41563796 CTCCTAGCTGCAGCATCCTTGGG - Intergenic
1157482695 18:48065754-48065776 CAGGTAGCTGCGGCATCCCAGGG + Intronic
1158002067 18:52630943-52630965 CAGCTAGCCATGGCATACTAAGG - Intronic
1158788539 18:60745620-60745642 CACCTTTCTGTGACATCCTATGG - Intergenic
1161320032 19:3636895-3636917 CACGTAGCTGTGAGATCCTCAGG - Intronic
1166738134 19:45098093-45098115 CACCTGGCTGTGGCTTGCTGAGG - Intronic
925036186 2:688150-688172 CTCCTTGCTGTGCCATCATATGG + Intergenic
925427348 2:3761581-3761603 AACCTGGCTGTTGCATCCTCAGG - Intronic
927138974 2:20117211-20117233 CTCCTCGCTGTGCCCTCCTATGG - Intergenic
929391721 2:41476280-41476302 ATCCTAGCTGAGTCATCCTATGG + Intergenic
932502049 2:72191469-72191491 CAACCAGCTGTGGCATCTTGGGG - Intronic
936088216 2:109484039-109484061 CACCAAGGTGTGCCATCCTCTGG + Intronic
936918227 2:117661615-117661637 CACCTGCCTGTTGGATCCTATGG - Intergenic
938000852 2:127735349-127735371 CACCGAGCTTTGGGATCCTATGG - Intronic
938734038 2:134170043-134170065 CACCTAGTTGGTGCATCATATGG - Intronic
940049887 2:149451183-149451205 CACCTTGCTGCTGCATCCTCTGG + Intronic
941711168 2:168714713-168714735 CTTCTAGCTGTGTCATCATATGG - Intronic
946097274 2:217286151-217286173 GACCTAAATTTGGCATCCTATGG - Intronic
947995610 2:234524709-234524731 CACCTTGCTGCTGCATCCTCTGG - Intergenic
948235058 2:236381152-236381174 CTCCTAGCTGTGTCTTCATATGG - Intronic
1169393979 20:5213703-5213725 AAACTTGCTGTGGCTTCCTAGGG - Intergenic
1169853399 20:10077731-10077753 CACATGACTGTGGCTTCCTAAGG + Intergenic
1174368032 20:50068199-50068221 TACCTGGCTGTGCCATCCAAAGG - Intergenic
1175432188 20:58913237-58913259 CACCTGGCTGTGGAATCCCATGG - Intergenic
1177094074 21:16809400-16809422 CATCTAGCTGTGTCCTCCCATGG - Intergenic
1177504766 21:22006200-22006222 CACCTTGTTGTTGCATCCTTTGG + Intergenic
1178264649 21:31131887-31131909 TTCCTAGCTGTGGCTTCATATGG - Intronic
1179449711 21:41460178-41460200 CACCAAGGTGTGACATCCTCTGG + Intergenic
1180871136 22:19148054-19148076 CAGCAATCTGTGCCATCCTAGGG - Intergenic
1181377844 22:22474708-22474730 CACCTTGCTGTGGTTTCCTGGGG - Intergenic
1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG + Intronic
950021695 3:9792390-9792412 CTCCTCGCTGCGGCCTCCTACGG + Exonic
952273995 3:31859614-31859636 CTTCTTGCTGTGGCATCCCATGG - Intronic
957971492 3:87388436-87388458 CACCTTGCTGTGTCATCACATGG + Intergenic
965752375 3:171989673-171989695 CACCCAGTTGTGGCAGCCTCGGG - Intergenic
965910801 3:173772896-173772918 CACCTCGCTTTTGCATCCAAAGG + Intronic
969129467 4:4981020-4981042 CACACAGCTGGGGCATCCAAGGG + Intergenic
976929804 4:90551972-90551994 CACCTTGATGTTGCATCCTCTGG + Intronic
977569850 4:98617752-98617774 CCGCTAGCTTTGGCTTCCTATGG - Intronic
979113496 4:116789661-116789683 CATCTTGCTGTGTCATCCCATGG - Intergenic
980180751 4:129397775-129397797 CACCTATCTGTGGCACCCAGTGG + Intergenic
986480705 5:8184181-8184203 CACCTAGCTTTTGCCTCCTTAGG + Intergenic
988536779 5:32075492-32075514 AACCTTGCTGTGGTATCATATGG + Intronic
990673293 5:58156657-58156679 CAGCTAGCTTTACCATCCTAAGG + Intergenic
998398382 5:141834542-141834564 CACCTGGCTTTTGCATCCTAGGG - Intergenic
1005079005 6:21938244-21938266 GACCTAGCTCAGGAATCCTACGG - Intergenic
1006671600 6:35732713-35732735 CAACTACCTGTGGAATCCTAAGG - Intergenic
1024003562 7:45208664-45208686 CAGGAAGCTGGGGCATCCTAGGG + Intergenic
1029887505 7:103888688-103888710 TACCAAGCTGTGGCATCATGGGG - Intronic
1033119664 7:138656405-138656427 TACCTGCCTTTGGCATCCTATGG - Intronic
1033564555 7:142565983-142566005 CACCTAACTGTGGGCTGCTATGG + Intergenic
1037199148 8:16229519-16229541 CTTCTTGCTGTGTCATCCTATGG - Intronic
1043813847 8:84777427-84777449 CACCTATCTGTGTGATCATAGGG + Intronic
1044464121 8:92483915-92483937 CACCTAGGTGTGGCCTCGTGAGG + Intergenic
1045683222 8:104684770-104684792 CTTCTTGCTGTGTCATCCTATGG + Intronic
1049877664 8:145036126-145036148 CAGCCAGCAGTGGCAACCTATGG + Intergenic
1051012133 9:12430067-12430089 CACCTAACTCTGGAATCCCAAGG + Intergenic
1059452102 9:114376968-114376990 CATCTATCTGTGGCATGCTGCGG + Exonic
1192899817 X:75484695-75484717 TACCTAGCTGTGGGATTCTTGGG - Intronic
1194633245 X:96312384-96312406 CTCCTCGCTGTGTCATCCCATGG + Intergenic
1199920387 X:152396377-152396399 CACTTTGTTGTGGCATCCTTGGG + Intronic
1199949394 X:152695379-152695401 CACCTATCAGTGGCAGCCAAGGG + Intergenic
1199960282 X:152773070-152773092 CACCTATCAGTGGCAGCCAAGGG - Intergenic