ID: 1068008839

View in Genome Browser
Species Human (GRCh38)
Location 10:51422336-51422358
Sequence GTCTAGGACTCACCTAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068008839_1068008845 5 Left 1068008839 10:51422336-51422358 CCACAGCTAGGTGAGTCCTAGAC No data
Right 1068008845 10:51422364-51422386 GCATGATGGGTAGTACAGAGGGG No data
1068008839_1068008843 3 Left 1068008839 10:51422336-51422358 CCACAGCTAGGTGAGTCCTAGAC No data
Right 1068008843 10:51422362-51422384 TAGCATGATGGGTAGTACAGAGG No data
1068008839_1068008840 -9 Left 1068008839 10:51422336-51422358 CCACAGCTAGGTGAGTCCTAGAC No data
Right 1068008840 10:51422350-51422372 GTCCTAGACGTTTAGCATGATGG No data
1068008839_1068008841 -8 Left 1068008839 10:51422336-51422358 CCACAGCTAGGTGAGTCCTAGAC No data
Right 1068008841 10:51422351-51422373 TCCTAGACGTTTAGCATGATGGG No data
1068008839_1068008844 4 Left 1068008839 10:51422336-51422358 CCACAGCTAGGTGAGTCCTAGAC No data
Right 1068008844 10:51422363-51422385 AGCATGATGGGTAGTACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068008839 Original CRISPR GTCTAGGACTCACCTAGCTG TGG (reversed) Intronic
No off target data available for this crispr