ID: 1068008840

View in Genome Browser
Species Human (GRCh38)
Location 10:51422350-51422372
Sequence GTCCTAGACGTTTAGCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068008839_1068008840 -9 Left 1068008839 10:51422336-51422358 CCACAGCTAGGTGAGTCCTAGAC No data
Right 1068008840 10:51422350-51422372 GTCCTAGACGTTTAGCATGATGG No data
1068008838_1068008840 1 Left 1068008838 10:51422326-51422348 CCATAGGATGCCACAGCTAGGTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1068008840 10:51422350-51422372 GTCCTAGACGTTTAGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068008840 Original CRISPR GTCCTAGACGTTTAGCATGA TGG Intronic
No off target data available for this crispr