ID: 1068018324

View in Genome Browser
Species Human (GRCh38)
Location 10:51545932-51545954
Sequence CTGAACTAGCTTTAGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068018309_1068018324 29 Left 1068018309 10:51545880-51545902 CCCCCTACACCCCCACCCAGCAC 0: 1
1: 0
2: 9
3: 108
4: 978
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018310_1068018324 28 Left 1068018310 10:51545881-51545903 CCCCTACACCCCCACCCAGCACC 0: 1
1: 0
2: 8
3: 118
4: 1000
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018323_1068018324 -7 Left 1068018323 10:51545916-51545938 CCTTCTCTTTTTTTCTCTGAACT No data
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018318_1068018324 13 Left 1068018318 10:51545896-51545918 CCAGCACCCCCTGTTTCTCTCCT 0: 1
1: 0
2: 4
3: 59
4: 607
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018315_1068018324 18 Left 1068018315 10:51545891-51545913 CCCACCCAGCACCCCCTGTTTCT 0: 1
1: 0
2: 4
3: 47
4: 394
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018320_1068018324 6 Left 1068018320 10:51545903-51545925 CCCCTGTTTCTCTCCTTCTCTTT 0: 1
1: 2
2: 69
3: 608
4: 4275
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018311_1068018324 27 Left 1068018311 10:51545882-51545904 CCCTACACCCCCACCCAGCACCC 0: 1
1: 0
2: 17
3: 106
4: 882
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018321_1068018324 5 Left 1068018321 10:51545904-51545926 CCCTGTTTCTCTCCTTCTCTTTT 0: 1
1: 2
2: 44
3: 602
4: 5051
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018317_1068018324 14 Left 1068018317 10:51545895-51545917 CCCAGCACCCCCTGTTTCTCTCC 0: 1
1: 1
2: 1
3: 31
4: 407
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018319_1068018324 7 Left 1068018319 10:51545902-51545924 CCCCCTGTTTCTCTCCTTCTCTT No data
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018322_1068018324 4 Left 1068018322 10:51545905-51545927 CCTGTTTCTCTCCTTCTCTTTTT 0: 1
1: 8
2: 466
3: 945
4: 4917
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018312_1068018324 26 Left 1068018312 10:51545883-51545905 CCTACACCCCCACCCAGCACCCC 0: 1
1: 1
2: 19
3: 213
4: 1787
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018313_1068018324 20 Left 1068018313 10:51545889-51545911 CCCCCACCCAGCACCCCCTGTTT 0: 1
1: 0
2: 3
3: 48
4: 491
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018316_1068018324 17 Left 1068018316 10:51545892-51545914 CCACCCAGCACCCCCTGTTTCTC 0: 1
1: 1
2: 3
3: 48
4: 502
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data
1068018314_1068018324 19 Left 1068018314 10:51545890-51545912 CCCCACCCAGCACCCCCTGTTTC 0: 1
1: 0
2: 5
3: 74
4: 603
Right 1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068018324 Original CRISPR CTGAACTAGCTTTAGCTGCA TGG Intronic
No off target data available for this crispr