ID: 1068020774

View in Genome Browser
Species Human (GRCh38)
Location 10:51581062-51581084
Sequence GCATTTATTAAGTTTAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068020770_1068020774 0 Left 1068020770 10:51581039-51581061 CCTCCAATGCACTGGATATACCA 0: 30
1: 83
2: 49
3: 16
4: 100
Right 1068020774 10:51581062-51581084 GCATTTATTAAGTTTAGTGAGGG No data
1068020767_1068020774 9 Left 1068020767 10:51581030-51581052 CCCACGATGCCTCCAATGCACTG 0: 1
1: 2
2: 10
3: 54
4: 160
Right 1068020774 10:51581062-51581084 GCATTTATTAAGTTTAGTGAGGG No data
1068020766_1068020774 18 Left 1068020766 10:51581021-51581043 CCTTCTGGTCCCACGATGCCTCC 0: 1
1: 1
2: 9
3: 46
4: 216
Right 1068020774 10:51581062-51581084 GCATTTATTAAGTTTAGTGAGGG No data
1068020768_1068020774 8 Left 1068020768 10:51581031-51581053 CCACGATGCCTCCAATGCACTGG 0: 1
1: 5
2: 11
3: 44
4: 157
Right 1068020774 10:51581062-51581084 GCATTTATTAAGTTTAGTGAGGG No data
1068020771_1068020774 -3 Left 1068020771 10:51581042-51581064 CCAATGCACTGGATATACCAGCA 0: 48
1: 23
2: 19
3: 6
4: 121
Right 1068020774 10:51581062-51581084 GCATTTATTAAGTTTAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068020774 Original CRISPR GCATTTATTAAGTTTAGTGA GGG Intronic
No off target data available for this crispr