ID: 1068021495

View in Genome Browser
Species Human (GRCh38)
Location 10:51590952-51590974
Sequence GTCTCAGGTCTGTTAATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068021495_1068021500 26 Left 1068021495 10:51590952-51590974 CCTGCAATTAACAGACCTGAGAC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1068021500 10:51591001-51591023 CATTGATTTCTAAATTCAGATGG No data
1068021495_1068021499 2 Left 1068021495 10:51590952-51590974 CCTGCAATTAACAGACCTGAGAC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1068021499 10:51590977-51590999 CTGACAGTTAGGGAGTGTACTGG No data
1068021495_1068021496 -9 Left 1068021495 10:51590952-51590974 CCTGCAATTAACAGACCTGAGAC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1068021496 10:51590966-51590988 ACCTGAGACAACTGACAGTTAGG No data
1068021495_1068021498 -8 Left 1068021495 10:51590952-51590974 CCTGCAATTAACAGACCTGAGAC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1068021498 10:51590967-51590989 CCTGAGACAACTGACAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068021495 Original CRISPR GTCTCAGGTCTGTTAATTGC AGG (reversed) Intronic
901133817 1:6979960-6979982 GTCTCAGTGCTGTGAATTGTGGG + Intronic
911578079 1:99601933-99601955 GTCGCACATGTGTTAATTGCAGG - Intergenic
911864573 1:103001671-103001693 TTCTCAGCTATGTTAATTTCAGG - Intronic
912001619 1:104842613-104842635 TTCTCAGGTCAAATAATTGCAGG + Intergenic
915440844 1:155944611-155944633 GTCCCAGTTCCTTTAATTGCTGG + Intergenic
916162088 1:161927218-161927240 GTCTCAGCTCTGTCAGTAGCTGG - Intronic
916607895 1:166361108-166361130 GGCTCAGGTCAGCTAATTGGAGG + Intergenic
917648160 1:177048835-177048857 GCCTTTGGTCTGTGAATTGCTGG - Intronic
917775583 1:178331014-178331036 GTCTCAGTTTCATTAATTGCTGG - Intronic
924920907 1:248628132-248628154 GCCTCAGTTCTGGTAAGTGCTGG - Intergenic
1064589610 10:16875179-16875201 GGCTCTGAGCTGTTAATTGCTGG - Intronic
1068021495 10:51590952-51590974 GTCTCAGGTCTGTTAATTGCAGG - Intronic
1070995156 10:80772235-80772257 ATCTCCTGTCTGTTAATTGGAGG + Intergenic
1071375764 10:85001276-85001298 ACTTCAGGTCTGTTAATTACTGG - Intergenic
1074653185 10:115548500-115548522 GTCCCAGGTCTGTTCACTTCTGG + Intronic
1078730113 11:13965696-13965718 GAATCAGGTTTGCTAATTGCAGG - Intronic
1082776815 11:57251666-57251688 GTCTCAGGTTTCTCACTTGCTGG + Intergenic
1083170497 11:60921608-60921630 ATCTCAGCTCTGTTTCTTGCTGG - Intronic
1085609004 11:77929630-77929652 TACTCAGGTCTGTTGATTGTAGG + Intronic
1085819055 11:79772479-79772501 AGCTCAGGTCTGTTGATTCCTGG + Intergenic
1095512257 12:42965306-42965328 GTCTCAGGTCTGCCACTTGCTGG - Intergenic
1100650691 12:96585512-96585534 GTCTTAGGTCTGTGAAGTGGGGG - Intronic
1104235268 12:126929231-126929253 GTCTCAGCTCTGCTAATGGCTGG - Intergenic
1105700118 13:22929390-22929412 GGCTCAGGTCTGAGAATTGAGGG + Intergenic
1107193726 13:37622015-37622037 GACTCAAGTTTGTTAAATGCAGG + Intergenic
1107568526 13:41631423-41631445 GTCTCAGCTCAGTTAGTTTCAGG + Intronic
1108416278 13:50201104-50201126 GTATCAGGCCTGTTAAATCCTGG + Intronic
1115394568 14:32893614-32893636 GTCTCTGCTCTGTTCTTTGCAGG + Intergenic
1121360567 14:93254566-93254588 GTCACATGGCTGTTAAATGCAGG - Intronic
1121527370 14:94628439-94628461 GACTTAGGTCTGGAAATTGCTGG + Intergenic
1123724559 15:23089129-23089151 GTGACAGACCTGTTAATTGCTGG + Intergenic
1127955694 15:63850813-63850835 GTATCAGGTCTGTTTCTTGTTGG - Intergenic
1128411900 15:67407906-67407928 GTATCAGAGCTGTTAATTACCGG + Intronic
1131404237 15:92150877-92150899 CTCTGGGGTCTGTTAATTACAGG + Intronic
1131578436 15:93615415-93615437 GTCTCAGTGCTCTTACTTGCTGG + Intergenic
1137509615 16:49087489-49087511 GTCTCAGATCTCTTTTTTGCTGG - Intergenic
1138032869 16:53574591-53574613 TTCTCATGTCTTTTCATTGCTGG + Intergenic
1143617271 17:8060038-8060060 CTCTCAGGACTGTAAATTGCAGG - Intergenic
1144872678 17:18380664-18380686 GTCTCAGGTCTGTGTGGTGCTGG - Intronic
1147266759 17:39238960-39238982 ATCTCAGTTCTGCTACTTGCTGG - Intergenic
1147846571 17:43408223-43408245 GTCTCAGGCCAGGTAATTACAGG - Intergenic
1155073051 18:22332943-22332965 GTCTCCCGTCAGTTAATTACGGG - Intergenic
1155605217 18:27597626-27597648 GGCTCAGGACTGAGAATTGCAGG + Intergenic
1167508596 19:49883967-49883989 GTCTCAGTTCTGTCAATGCCTGG + Intronic
1168065748 19:53919369-53919391 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168065791 19:53919530-53919552 GCCTCAGGTCTGGTCATTGGTGG + Intronic
1168066020 19:53920377-53920399 GCCTCAGGTCTGGTCATTGGTGG + Intronic
1168066151 19:53920884-53920906 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168066258 19:53921284-53921306 GCCTCAGGTCTGGTCATTGGTGG + Intronic
1168066381 19:53921767-53921789 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168066552 19:53922420-53922442 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168066571 19:53922500-53922522 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168066628 19:53922742-53922764 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168066672 19:53922929-53922951 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168066731 19:53923172-53923194 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168066804 19:53923468-53923490 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168066823 19:53923548-53923570 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168066861 19:53923709-53923731 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168066985 19:53924173-53924195 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168067052 19:53924445-53924467 GTCCCAGGTCTGGTCATTGGTGG + Intronic
1168067256 19:53925290-53925312 GTCCCAGGTCTGGTCATTGGTGG + Intronic
927632926 2:24789936-24789958 GGCTCACATCTGTTAATTCCAGG - Exonic
928822758 2:35382397-35382419 GTTTCACTTCTGATAATTGCAGG + Intergenic
930093096 2:47545606-47545628 ATCTCAGCTCTGTCACTTGCTGG + Intronic
935047207 2:99493071-99493093 GGCTCAGGGCTGTTACTTGAGGG + Intergenic
936916359 2:117642845-117642867 GTCTGATTTCTGTTACTTGCAGG - Intergenic
937668452 2:124513864-124513886 GGATCAGCTCTGTTAACTGCAGG - Intronic
939126074 2:138178968-138178990 TTCTCAGGGGTGTTAATTTCTGG + Intergenic
946212175 2:218156115-218156137 GTCTCAGGGCTGTGCAGTGCAGG - Intergenic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1169983736 20:11418618-11418640 ATTTCAGGTCTGATAATTCCAGG + Intergenic
1170694200 20:18643384-18643406 GTCTCAGGTCTGATCTTTCCTGG + Intronic
1171565958 20:26187772-26187794 GTTTAAGGGCTGTTGATTGCTGG - Intergenic
1172004104 20:31805659-31805681 GTCTCATCTCTGTTAAATGCTGG - Intergenic
1173878046 20:46388725-46388747 GTGACAGACCTGTTAATTGCTGG - Intronic
1174236852 20:49101104-49101126 CTCTCAGGCTTGCTAATTGCTGG + Intergenic
1179594907 21:42437042-42437064 GACTGAGGTCTGTTCCTTGCTGG + Intronic
1184998585 22:48227899-48227921 CACTCAGGTCTGCTAATTTCTGG + Intergenic
950358634 3:12434019-12434041 GTCTGAGGTCTGTCATTTTCTGG - Exonic
951630370 3:24713679-24713701 TTCTCTGGGCTGGTAATTGCAGG - Intergenic
951986277 3:28625162-28625184 GACTCAGGGCTGTTAATAGATGG + Intergenic
953588983 3:44233334-44233356 GTCACAGGGCTGGTAAATGCTGG + Intergenic
954108465 3:48421472-48421494 GCCTGAGGGCTGTTGATTGCTGG - Intronic
954722627 3:52578446-52578468 GTCCCAGCTCTGTTAGTTGTAGG - Intronic
956605395 3:71068261-71068283 GTCCCAGGTGTGTTATTTGGTGG - Intronic
958092671 3:88896148-88896170 GTCTGAGGTCTGTTATGTGCAGG + Intergenic
958456129 3:94333717-94333739 GTCTAAGTTCTTTTAATTGCTGG - Intergenic
964421637 3:156510180-156510202 GCCTCAGGTCTTTTTGTTGCTGG - Intronic
965022281 3:163247974-163247996 GTCTCATGTCTGTAAATTTGAGG + Intergenic
967224033 3:187274395-187274417 GTCTCAGGTCTGCTACTTGTAGG - Intronic
967574296 3:191072472-191072494 GTTTCATGTCTGATAATTTCAGG - Intergenic
969494414 4:7518314-7518336 GTCTCTGGTCTGTAACTTGGCGG + Intronic
972029432 4:34434743-34434765 GTTTAAGGGCTGTTGATTGCTGG - Intergenic
977082139 4:92544165-92544187 GTCTCAGCTCAGATAATTACAGG - Intronic
980140902 4:128915558-128915580 TTCTTAGGTCTGTTAAATACTGG + Intronic
980762793 4:137258072-137258094 TTCTCAGGTTTCTTAATTTCTGG - Intergenic
986203504 5:5600814-5600836 GTCTCATGTCAGTTCACTGCAGG + Intergenic
987455636 5:18142533-18142555 GTTACAGGTCTGTTAAGTGGTGG + Intergenic
992640049 5:78761356-78761378 GTCTCAGATCTGTCTATTACCGG + Intronic
994657316 5:102609605-102609627 GCCAAAGGTCTGATAATTGCTGG - Intergenic
999467748 5:151823218-151823240 GTCCCAGCTCTATCAATTGCTGG + Intronic
1000915395 5:167075166-167075188 TTTTCTGGTCTGTTACTTGCTGG - Intergenic
1002080232 5:176733283-176733305 GTCTCAGGTGTCTTCACTGCTGG - Intergenic
1008854218 6:56062211-56062233 TTCTCTGGTCTCTTAATTACTGG - Intronic
1011615985 6:89198864-89198886 GTCTCAGGTCTGCTTTTTGGTGG + Intronic
1014055541 6:117010716-117010738 ATCTCTGGTGTGTTAATGGCTGG + Intergenic
1020285167 7:6673209-6673231 TTATCAGGTCTCTTAATTTCTGG - Intergenic
1025843890 7:65178178-65178200 TACTCAGGTCTGTTGATTGTAGG - Intergenic
1025894223 7:65684489-65684511 TACTCAGGTCTGTTGATTGTAGG - Intergenic
1026284720 7:68953180-68953202 GTCTGAGGTGTGAGAATTGCTGG + Intergenic
1032188355 7:129747106-129747128 GGCTCAAGTCTGTTAGTTTCTGG + Intronic
1035843853 8:2842110-2842132 GACTCCGGTCTGATAATTGCTGG + Intergenic
1039173679 8:34779746-34779768 CTCTCAGGTTTGTTAATTCCCGG - Intergenic
1040440671 8:47438265-47438287 GTTTCAGGCCTGTGCATTGCTGG + Intronic
1044467399 8:92523775-92523797 GTCTCAGTTCTTCTACTTGCTGG + Intergenic
1047208575 8:122822418-122822440 GTCTGAGGTCTGCTACTCGCTGG - Intronic
1047594061 8:126358635-126358657 ATCTCAGCTCTGCTACTTGCTGG - Intergenic
1050421375 9:5468773-5468795 GTCTGAGGTCTGCTATTTACTGG - Exonic
1057963043 9:99475613-99475635 GTCTGAGGTCTGTGAATCACGGG - Intergenic
1059497363 9:114720735-114720757 GTCTCAGCTCTGACACTTGCCGG + Intergenic
1059979422 9:119753470-119753492 GTCTCAGTTCTGCTTCTTGCTGG - Intergenic
1060336473 9:122727991-122728013 GTCGCAGGCTTGTTAATGGCAGG + Intergenic
1061791146 9:133059779-133059801 CTCTCACGTCTGTCAATTGCAGG + Intergenic
1191713616 X:64178463-64178485 GTCTCTGGGCTTTCAATTGCAGG + Intergenic
1196080511 X:111625473-111625495 GTCTCTAGACTTTTAATTGCAGG - Intergenic