ID: 1068021637

View in Genome Browser
Species Human (GRCh38)
Location 10:51592809-51592831
Sequence TGTATGCTACATCTCATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068021634_1068021637 1 Left 1068021634 10:51592785-51592807 CCAACTCAAATATTCTGACCAGT 0: 1
1: 0
2: 1
3: 12
4: 173
Right 1068021637 10:51592809-51592831 TGTATGCTACATCTCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068021637 Original CRISPR TGTATGCTACATCTCATGAA GGG Intronic
No off target data available for this crispr