ID: 1068024830

View in Genome Browser
Species Human (GRCh38)
Location 10:51629743-51629765
Sequence GACCCACTTGTTAATAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 1, 2: 17, 3: 23, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068024830_1068024839 20 Left 1068024830 10:51629743-51629765 CCTGGCTTATTAACAAGTGGGTC 0: 1
1: 1
2: 17
3: 23
4: 63
Right 1068024839 10:51629786-51629808 TTCGCGGGTATTTTATGGTTGGG No data
1068024830_1068024832 4 Left 1068024830 10:51629743-51629765 CCTGGCTTATTAACAAGTGGGTC 0: 1
1: 1
2: 17
3: 23
4: 63
Right 1068024832 10:51629770-51629792 ATCCATTCCTTTCCAGTTCGCGG No data
1068024830_1068024838 19 Left 1068024830 10:51629743-51629765 CCTGGCTTATTAACAAGTGGGTC 0: 1
1: 1
2: 17
3: 23
4: 63
Right 1068024838 10:51629785-51629807 GTTCGCGGGTATTTTATGGTTGG No data
1068024830_1068024836 15 Left 1068024830 10:51629743-51629765 CCTGGCTTATTAACAAGTGGGTC 0: 1
1: 1
2: 17
3: 23
4: 63
Right 1068024836 10:51629781-51629803 TCCAGTTCGCGGGTATTTTATGG No data
1068024830_1068024840 21 Left 1068024830 10:51629743-51629765 CCTGGCTTATTAACAAGTGGGTC 0: 1
1: 1
2: 17
3: 23
4: 63
Right 1068024840 10:51629787-51629809 TCGCGGGTATTTTATGGTTGGGG No data
1068024830_1068024833 5 Left 1068024830 10:51629743-51629765 CCTGGCTTATTAACAAGTGGGTC 0: 1
1: 1
2: 17
3: 23
4: 63
Right 1068024833 10:51629771-51629793 TCCATTCCTTTCCAGTTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068024830 Original CRISPR GACCCACTTGTTAATAAGCC AGG (reversed) Intronic
905759886 1:40546570-40546592 TACCCACTTGTTGATGAACCAGG + Exonic
909050636 1:70763651-70763673 GGCCCACATGATGATAAGCCAGG - Intergenic
909122267 1:71618259-71618281 GACCCATTTGTGAATAAGCCAGG + Intronic
909390639 1:75117095-75117117 GACCCATTTGTTATTCAACCAGG + Intergenic
911792338 1:102033415-102033437 GACCCATTTGTTAATAAGCCAGG + Intergenic
917757631 1:178118525-178118547 AACCCATTTGTGACTAAGCCAGG - Intronic
918750965 1:188268777-188268799 GACCCATTTGTGAATAAGCCAGG - Intergenic
919091303 1:192981361-192981383 AATCCATTTGTGAATAAGCCAGG + Intergenic
920793038 1:209110792-209110814 GACCCACTTGTTATAAATCAGGG - Intergenic
920924894 1:210331540-210331562 GATCCATTTGTGAATAAGCCAGG - Intronic
921291074 1:213658253-213658275 GACCCACTTGTAGATGAGCCTGG + Intergenic
921743456 1:218711860-218711882 GACCCAGTTGTGAATAAGGCAGG - Intergenic
923262741 1:232282954-232282976 CATCCACTGGTTATTAAGCCTGG - Intergenic
1068024830 10:51629743-51629765 GACCCACTTGTTAATAAGCCAGG - Intronic
1068163350 10:53296950-53296972 GACCCATTTGTGAATAAGCCAGG - Intergenic
1072859011 10:98983586-98983608 GACCCATTTGTGAATAAGCCAGG - Intronic
1074628218 10:115218477-115218499 GACCCATTTGCGAGTAAGCCAGG - Intronic
1078826131 11:14931917-14931939 GACCCATTTTTTAATAAGCCAGG - Intronic
1079000598 11:16751806-16751828 AACCCATTTGTGAATAAGCCAGG + Intronic
1079570105 11:21932447-21932469 AACCCATTTGTGAATAAGCCAGG + Intergenic
1081153135 11:39656711-39656733 GACCTATTTATTAATAACCCAGG - Intergenic
1081254543 11:40876212-40876234 GACCCATTTGTGAATAAGCCTGG - Intronic
1087284671 11:96252087-96252109 GACCCAATTGGAAATTAGCCAGG - Intronic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1092309857 12:7340753-7340775 GAAGCCCTTGATAATAAGCCTGG - Intergenic
1094714144 12:32994902-32994924 GACCCACTTGGGAATCAGCTGGG + Intergenic
1106889268 13:34225618-34225640 GACTCTCATGTGAATAAGCCTGG + Intergenic
1110075448 13:71235319-71235341 GACCCACTTTTTAAAAAATCTGG + Intergenic
1112144345 13:96680669-96680691 GACCAACTTGTGAAGAAGACTGG + Intronic
1113401416 13:109997458-109997480 AACCCATTTGTGAGTAAGCCAGG + Intergenic
1114246635 14:20920547-20920569 GACCTACTTGTGAAGAGGCCAGG - Intergenic
1116140401 14:40986134-40986156 AACCCATTTGTGAATAAGCCAGG - Intergenic
1119469268 14:74883754-74883776 CACCCAGCTGTTGATAAGCCAGG + Intronic
1120141259 14:80932328-80932350 AACCCACTTGTAAATAAACCAGG + Intronic
1124224860 15:27884530-27884552 GACCCTCATGTTTATATGCCTGG + Intronic
1126457229 15:48876941-48876963 GACCCATTTGTGAATAAGCCAGG + Intronic
1131631769 15:94184755-94184777 GACCCATCTGTGAATAAGCCAGG - Intergenic
1149140030 17:53421111-53421133 GACCCATTTGTGAATAAGCCAGG + Intergenic
1150094599 17:62362460-62362482 GACAGACTTTTTAATAAGTCAGG + Intergenic
1152163790 17:78687502-78687524 GACCCATTTGAGAATAAGCCAGG - Intronic
1153501208 18:5751820-5751842 AACCCACTTGGAAATAAGCTAGG - Intergenic
1155112228 18:22727308-22727330 GACTCATTTGTGAATATGCCAGG + Intergenic
1158581946 18:58691487-58691509 GCCACACTTGTTAAGAGGCCAGG - Intronic
1159792516 18:72800181-72800203 GACCCATTTGTGAATAAGCCAGG + Intronic
926824684 2:16892689-16892711 AACCCATTTGTGAATAAGCCAGG + Intergenic
927630293 2:24767402-24767424 GAACAACTTTTTAATAAGGCTGG + Intronic
928481259 2:31686400-31686422 GACCCCCATGTTAGTAAGCAAGG + Intergenic
928504168 2:31932077-31932099 GATCCACTTGTTTATAAGCATGG + Exonic
933480501 2:82851385-82851407 GACCCATTTCTGAATAAGCCAGG - Intergenic
937165906 2:119816954-119816976 GACCCATTTGTGAATAAACCAGG - Intronic
938995661 2:136674814-136674836 GACCCATTTCTTAATAAGGAAGG + Intergenic
939291540 2:140202353-140202375 AACCCATTTGTGAATAAGCCAGG - Intergenic
939291557 2:140202575-140202597 AACCCATTTGTGAATAAGCCAGG - Intergenic
942028957 2:171939119-171939141 GACCCATTTTTGAATAAGTCAGG - Intronic
943818709 2:192290659-192290681 AACCCATTTGTGAATAAGCCAGG - Intergenic
944171333 2:196782106-196782128 GACCCACCTCTTAATAACCTTGG - Intronic
944339375 2:198578057-198578079 GACTCACTTGTTAAAAACCTGGG + Intergenic
946548536 2:220774759-220774781 GACCCAATTGTTAAATAGTCAGG + Intergenic
948567752 2:238897402-238897424 GTCCCACTTGGTAAAAAGGCAGG - Intronic
1170744195 20:19084156-19084178 GACCCATTTGTGAATAAGCCAGG + Intergenic
1175584880 20:60131344-60131366 GACCCACTAGTGAATGAGGCAGG - Intergenic
1177273893 21:18881898-18881920 TACCCATTTTTAAATAAGCCAGG - Intergenic
1178612516 21:34096687-34096709 GACCAACCTGATAATAGGCCGGG + Exonic
1178840035 21:36130668-36130690 GATCCACTTGTTTATAAGCATGG - Intergenic
1181345270 22:22215451-22215473 CACACATTTGTTAATAAGGCAGG - Intergenic
1184453482 22:44596542-44596564 ACCCCACCTGTTAGTAAGCCAGG - Intergenic
949305799 3:2639310-2639332 GCCCCACCTGTTAACATGCCAGG + Intronic
950758446 3:15198189-15198211 AACCCATTTGTGAATAAGCCAGG - Intergenic
952747281 3:36792999-36793021 GCACCCCTTGTTAATAAGGCAGG + Intergenic
956852707 3:73245468-73245490 GAGCCACATGTTAAAAAGGCTGG - Intergenic
959240549 3:103786583-103786605 GATCCAGTAGTTCATAAGCCAGG - Intergenic
963537511 3:146545961-146545983 GACCCATTTGTGAGTAAGTCAGG - Intergenic
966518718 3:180849316-180849338 TATTGACTTGTTAATAAGCCAGG - Intronic
971863568 4:32140128-32140150 GACTTACATGTGAATAAGCCAGG + Intergenic
975625337 4:76340368-76340390 CACCCATTTGTGAATAAACCAGG + Intronic
976441936 4:85085774-85085796 GGCCCACTTGCCAACAAGCCTGG - Intergenic
978222448 4:106293101-106293123 AACCCATTTGTGAATAAACCAGG + Intronic
979623227 4:122818974-122818996 CACCCATTTGTGGATAAGCCAGG - Intergenic
979829210 4:125279947-125279969 GACCCAGTTGTGAATAAGCCAGG + Intergenic
982039818 4:151385712-151385734 GCCCCATTTGTGAATAAGTCAGG - Intergenic
985515415 5:341966-341988 AACCCACTTTTAAATAAGCAAGG - Intronic
985753438 5:1697538-1697560 GACCCATTTGTGAATAAGCCAGG - Intergenic
989077839 5:37583469-37583491 GACACATTTGTTCATAAGCCAGG - Intronic
989705293 5:44322507-44322529 GACCCATTTATGAATAAGCCAGG + Intronic
991220473 5:64209485-64209507 GACATACTTATTAATATGCCAGG - Intronic
994772899 5:104005900-104005922 GACCAACTTATGAATAGGCCAGG + Intergenic
995861374 5:116644420-116644442 CACCCATTTGTGAATAAGCCAGG - Intergenic
997137404 5:131341488-131341510 GTCCCACTTCTTAGGAAGCCAGG + Intronic
1003563042 6:7199442-7199464 GCCCCAATTGTTAAGAAGCTGGG - Intronic
1005339243 6:24827954-24827976 GAGCCCCTTGTTAATGAACCAGG - Intronic
1009523603 6:64715543-64715565 AGCCCATTTGTGAATAAGCCAGG - Intronic
1009674175 6:66795448-66795470 GACCCATTTGTGAATAAGCCAGG - Intergenic
1012382833 6:98640742-98640764 GACACACATGTTAATAAGTGAGG + Intergenic
1013036098 6:106384823-106384845 GACCCATTTGTGAATAAGCCAGG - Intergenic
1015599454 6:134898053-134898075 GATCCACTTGTTTATAAGCATGG - Intergenic
1018596533 6:165487057-165487079 GACGCATTTGTGAATAAGCCCGG + Intronic
1018664547 6:166123124-166123146 GACCCATTTGTGAATAAGCCCGG - Intergenic
1024620598 7:51154158-51154180 GGCCAACATGTTAGTAAGCCTGG - Intronic
1045523659 8:102925145-102925167 CACCCAGTGGTTCATAAGCCCGG - Intronic
1045813085 8:106246792-106246814 GACCCACGTGTGAATAAGCCAGG + Intergenic
1057775816 9:98008416-98008438 AACCCATTTATGAATAAGCCAGG + Intronic
1058155398 9:101509098-101509120 GACCCATTTGTGAATAAGCCAGG - Intronic
1193750856 X:85341672-85341694 GAGCCACCTGTTAATGAGCGAGG + Intronic
1196264949 X:113632354-113632376 GACACACTTTTTATTAAGTCTGG + Intergenic