ID: 1068024847

View in Genome Browser
Species Human (GRCh38)
Location 10:51629874-51629896
Sequence GGTTTGAAAGAGATGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 328}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068024847 Original CRISPR GGTTTGAAAGAGATGGAGCC AGG (reversed) Intronic
901805954 1:11738701-11738723 GGTTCTAAAGTCATGGAGCCAGG + Intronic
902722667 1:18314586-18314608 GCTTTGCAAGTGAAGGAGCCAGG + Intronic
902980818 1:20121656-20121678 AGTTGGTAAGAGAAGGAGCCAGG - Intergenic
903020438 1:20390058-20390080 GGTCTGCAGGAGCTGGAGCCTGG - Intergenic
903077808 1:20786195-20786217 CGTTTGTAAGAGATGGAGGCAGG - Intronic
903137617 1:21319638-21319660 AGTTGGACAGGGATGGAGCCTGG - Intronic
903179304 1:21597394-21597416 GGATGGAAAGACCTGGAGCCTGG - Intronic
903528906 1:24014447-24014469 TTTTTTAATGAGATGGAGCCTGG + Intergenic
905191134 1:36235859-36235881 GGTAGAAAAGAGATGGAGACAGG + Intronic
905878328 1:41447786-41447808 AGCTTGTAAGAGATGGAGGCAGG + Intergenic
907778088 1:57538418-57538440 GTTTTGCAGGAAATGGAGCCAGG - Intronic
907868953 1:58425603-58425625 GGATGAAAAGAGAAGGAGCCAGG + Intronic
907882809 1:58566801-58566823 GCTTTGAGAGAGATGGAGGTGGG + Intergenic
909357896 1:74730251-74730273 GGCTTGAAAGTGATGGGGCATGG + Intronic
912171030 1:107099434-107099456 AGTTTGGAAGAGATGAAGTCAGG + Intergenic
912563254 1:110565459-110565481 GATTTGAAAGGGGTGGAGGCAGG + Intergenic
916265862 1:162889227-162889249 AGTTTGTAAGTGATGGAGTCAGG + Intergenic
917745954 1:178007365-178007387 CGTTTGACAGAGATGGAGGGTGG + Intergenic
918017040 1:180645326-180645348 ATTTTGAAAGAGACTGAGCCAGG - Intronic
918750979 1:188268909-188268931 ATTTTGAAAGAGACTGAGCCAGG - Intergenic
919091285 1:192981229-192981251 ATTTTGAAAGAGACTGAGCCAGG + Intergenic
919973061 1:202593146-202593168 AGGTAGAAAGAGATTGAGCCAGG - Exonic
920347367 1:205314973-205314995 GAGTTGAAAGAGATGGATCTTGG - Intronic
922194150 1:223345399-223345421 GCTTATTAAGAGATGGAGCCAGG + Intronic
922194161 1:223345459-223345481 GCTTATTAAGAGATGGAGCCAGG + Intronic
922515383 1:226204141-226204163 TGTTTTAAATAGATGTAGCCTGG - Intergenic
922616408 1:226963539-226963561 GGCTTGACAGTGAGGGAGCCTGG - Intronic
923046165 1:230357176-230357198 GGTTTGGGAGCGACGGAGCCTGG - Exonic
924599452 1:245475533-245475555 TATTTGTAAGAGATGGAGTCTGG - Intronic
924647047 1:245887559-245887581 GGTTTCAAAGAGATTCAGTCTGG - Intronic
1064359661 10:14652470-14652492 GGCAAGAAAGAGCTGGAGCCAGG - Intronic
1064588308 10:16862291-16862313 GGTTTGTAAGAGGTAAAGCCAGG - Intronic
1065955051 10:30686163-30686185 GGTTTGATGGAGAAGGACCCAGG - Intergenic
1066003750 10:31128505-31128527 GTTTTGAAAGAGAAGTGGCCTGG - Intergenic
1066016033 10:31244803-31244825 GGTTTGAAGTGCATGGAGCCAGG - Intergenic
1066757895 10:38729358-38729380 AGTTTCCAAGAGATGGAGGCAGG + Intergenic
1067373636 10:45707553-45707575 GGTTTGCAAGTGGTGGAGCTGGG + Intergenic
1067380053 10:45764674-45764696 GGTTTGCAAGTGGTGGAGCTGGG - Intronic
1067716886 10:48696949-48696971 GGTTAGGAAGAGATGGAGCTGGG + Intronic
1067881459 10:50049324-50049346 GGTTTGCAAGTGGTGGAGCTGGG + Intergenic
1067887752 10:50105329-50105351 GGTTTGCAAGTGGTGGAGCTGGG - Intronic
1068024847 10:51629874-51629896 GGTTTGAAAGAGATGGAGCCAGG - Intronic
1068163371 10:53297082-53297104 GTTTTGAAAGAGACTTAGCCAGG - Intergenic
1070187052 10:74074399-74074421 GGTTTGTAGTAGATGGAGCCAGG + Intronic
1070635180 10:78119819-78119841 GGGTAGTAAGTGATGGAGCCAGG - Intergenic
1070649633 10:78225569-78225591 GGTTAGCAAGAGATGGCGCAGGG + Intergenic
1070743052 10:78914994-78915016 GGTTTGTAAGTGATAGAGCAAGG - Intergenic
1072863531 10:99032461-99032483 GGTTTGAAAGGGATGGGGCAGGG - Intronic
1074025500 10:109629542-109629564 TGTTGGAAAGAGACGGAGCTTGG + Intergenic
1075635725 10:124029043-124029065 GGTTGTAATGAGAGGGAGCCAGG + Intronic
1075687265 10:124372953-124372975 GGTTTGAAGGCTATGTAGCCTGG - Intergenic
1076139706 10:128069291-128069313 AGTTTGACAGAGAGGGAGGCTGG + Intronic
1076652369 10:131998728-131998750 GCTTTGAAAGAGACAGAGCCGGG - Intergenic
1077702125 11:4452472-4452494 GGTTAGATAGGGAAGGAGCCTGG + Intergenic
1077898105 11:6469222-6469244 GCTTGGAGAGAGGTGGAGCCTGG - Intronic
1078452425 11:11450125-11450147 GGGAAGTAAGAGATGGAGCCAGG + Intronic
1078580761 11:12537931-12537953 GCTTGGAAGGAGATGCAGCCTGG - Intergenic
1078705204 11:13737216-13737238 GTTTTCAAAGAGATGAAGCTAGG - Intergenic
1079087277 11:17455600-17455622 GGTTTAAAAGGGATAGAACCTGG + Intronic
1079611469 11:22437506-22437528 GGCATGGAAGAAATGGAGCCTGG - Intergenic
1080103277 11:28484447-28484469 GGGTTGAAAGACATGTAGGCTGG - Intergenic
1080760755 11:35246623-35246645 GCTAGGAAAGGGATGGAGCCAGG + Intergenic
1080913795 11:36633790-36633812 AGTTTGAAAGAGATGAATCTAGG - Intronic
1081283887 11:41245366-41245388 GGTGTGTAAGTGAGGGAGCCTGG + Intronic
1081410048 11:42747118-42747140 GATTTCGAAGAGATGGATCCTGG + Intergenic
1081576307 11:44320328-44320350 GGTTTGAGAGAGAGGAAGCTTGG - Intergenic
1085600973 11:77855653-77855675 GGTTTGAAAAATTTGCAGCCTGG - Intronic
1085663321 11:78390202-78390224 GGTTTGAAATAAATGAAACCAGG + Intronic
1085766609 11:79288641-79288663 GTCTTGCAAGAGACGGAGCCGGG - Intronic
1085777170 11:79377433-79377455 GCTGTGAATGAGATGAAGCCTGG - Intronic
1085939445 11:81191284-81191306 GGTCTTAAGGAGATGGAGGCAGG + Intergenic
1087018663 11:93579907-93579929 GGTTTGGAAGGAAGGGAGCCGGG + Intergenic
1087952273 11:104237457-104237479 GGTTTGCAGGAGATGGAGTTGGG + Intergenic
1088547537 11:110974908-110974930 GGCTAACAAGAGATGGAGCCAGG - Intergenic
1088619695 11:111669571-111669593 TTTTTAAAAGAGATGGAGGCGGG - Intronic
1090100879 11:123795689-123795711 CATTTCAAAGAGATGGATCCTGG + Intergenic
1091030743 11:132185716-132185738 GGTTTAAAAGATATGGAGGAGGG + Intronic
1092515625 12:9208642-9208664 ATTTTGAAAGAGATGGAGAAAGG - Intergenic
1092859954 12:12711817-12711839 GGATTGAGAGAGATGGAGAAAGG - Intergenic
1094352798 12:29545341-29545363 TGTTTTAAAGAGATGGAGGCCGG + Intronic
1095053905 12:37578320-37578342 AGTTTTACAAAGATGGAGCCTGG - Intergenic
1097943773 12:65343692-65343714 GGGTAGTAAGAGATGGAGCTAGG + Intronic
1099921013 12:88957155-88957177 AGTTAGAAGGAGGTGGAGCCAGG - Intergenic
1100189557 12:92176294-92176316 GGTTGGAATGAGATGGGGGCTGG - Intergenic
1100434200 12:94556941-94556963 GGTTCCAAAGAGAGCGAGCCAGG + Intergenic
1100602811 12:96126646-96126668 TGTTTGAAAGTGTTGGGGCCAGG - Intergenic
1104234356 12:126918616-126918638 GGTTTTTAAGAGTTGGAGCGTGG - Intergenic
1104912984 12:132248778-132248800 GATTTCACAGAGATGGGGCCAGG - Intronic
1106329702 13:28728964-28728986 GGTTTTAAATAGATTGATCCAGG - Intergenic
1106920069 13:34553710-34553732 GGTTTAAAATAGATTGAGCCTGG + Intergenic
1107182610 13:37479135-37479157 GGATTGAAAGAGAGAGAGACAGG - Intergenic
1107655499 13:42588852-42588874 GGTATGAAAGAGGTGGGTCCCGG + Intronic
1108228241 13:48312606-48312628 GGTTTAAAATAGAAGGAGTCTGG - Intronic
1108576711 13:51797336-51797358 GTTCTGAAAGAGCTGGAACCAGG - Intronic
1109359727 13:61280534-61280556 AGTTTGAAAAATATGCAGCCTGG + Intergenic
1110482272 13:75993246-75993268 ATTTTGAAAGAGATGGACCCAGG - Intergenic
1114472683 14:22974614-22974636 GGGATAGAAGAGATGGAGCCTGG + Intronic
1115773520 14:36690435-36690457 TGCTTGTAAGAGGTGGAGCCTGG + Intronic
1115791171 14:36880185-36880207 TTTTTTAAAGAGAAGGAGCCTGG + Intronic
1116140415 14:40986265-40986287 ATTTTGAAAGAGACTGAGCCAGG - Intergenic
1117157960 14:52959351-52959373 GGTTTGAAAGAGCTAGGGACTGG + Intergenic
1117243304 14:53857675-53857697 GGTTAGATTGAGATGGATCCTGG - Intergenic
1118391801 14:65302150-65302172 GGCATGAAAGAGCTGGAGGCAGG - Intergenic
1118705084 14:68472700-68472722 GGTTTGAATGAGCGGGAGCTGGG + Intronic
1119660421 14:76447513-76447535 GGTGTGAAAGGAATGGAGCTTGG - Intronic
1120141190 14:80931820-80931842 ATTTTGAAAGAGACTGAGCCAGG + Intronic
1120618371 14:86734266-86734288 GGTTTTAAAGAGATGGTAACGGG - Intergenic
1120699401 14:87681956-87681978 GGTTTGAAAGTCCTGGGGCCAGG - Intergenic
1120977080 14:90258127-90258149 AGCTTGTCAGAGATGGAGCCAGG - Intronic
1121417609 14:93789573-93789595 TGTCTGAAAGAGATGCAACCAGG - Intergenic
1122457113 14:101863004-101863026 TTTTTTAAAGAGATGGAGTCTGG + Intronic
1122563590 14:102635009-102635031 TTTTTTAAAGAGATGGAGTCTGG + Intronic
1122670254 14:103366343-103366365 GCATTGAAAGAGATAGAGGCTGG - Intergenic
1122916960 14:104863891-104863913 GGTTTGAAAGAGAGAGCTCCGGG - Intergenic
1122961152 14:105094079-105094101 GGGTTGGAGGAGATGGAGGCAGG - Intergenic
1124393863 15:29283507-29283529 GGATTGATAGAGATGGGGCCAGG - Intronic
1125835326 15:42745769-42745791 CCTTTCAAAGAGATGCAGCCTGG + Exonic
1125925921 15:43563100-43563122 ACTTTGAAAGAGAGTGAGCCTGG + Intronic
1125939065 15:43662651-43662673 ACTTTGAAAGAGAGTGAGCCTGG + Intronic
1126457170 15:48876304-48876326 ATTTTGAAAGAGACTGAGCCAGG + Intronic
1126946807 15:53830714-53830736 TGTTTGAAGGACTTGGAGCCTGG + Intergenic
1127464115 15:59227122-59227144 GGTGTGAAGGAGGTAGAGCCCGG - Intronic
1128558947 15:68651839-68651861 GCTTTGAAGGAAATGGAGCAAGG - Intronic
1128609068 15:69059400-69059422 GACTTCACAGAGATGGAGCCTGG - Intronic
1128693483 15:69743177-69743199 GGTTAGCAAGTGATGGAGTCTGG + Intergenic
1128889180 15:71315575-71315597 GGTTTCAAGGAGGCGGAGCCTGG - Intronic
1129006008 15:72374238-72374260 GGTTTAGAAGAGTTTGAGCCTGG - Intronic
1129446838 15:75625074-75625096 GGGTTGAAACAGCAGGAGCCCGG - Intronic
1131631789 15:94184885-94184907 ATTTTGAAAGTGATGGAGGCAGG - Intergenic
1133424547 16:5676541-5676563 GGATTGAATGAGATTGTGCCTGG + Intergenic
1134509437 16:14834322-14834344 AGTTTTAAAGAAATGGAGTCTGG - Intronic
1134697142 16:16233137-16233159 AGTTTTAAAGAAATGGAGTCTGG - Intronic
1134974703 16:18561548-18561570 AGTTTTAAAGAAATGGAGTCTGG + Intronic
1135160883 16:20095196-20095218 AGGTAGTAAGAGATGGAGCCAGG - Intergenic
1136063443 16:27742569-27742591 GGGTTGGAGGTGATGGAGCCAGG - Intronic
1136724972 16:32349870-32349892 AGTTTCCAAGAGATGGAGGCGGG - Intergenic
1136843301 16:33555923-33555945 AGTTTCCAAGAGATGGAGGCGGG - Intergenic
1137406633 16:48194163-48194185 GGTTTGGAAGTGGTGGAGCCAGG - Intronic
1138138867 16:54549205-54549227 AGATTGAAAGAGATAGAGCTTGG - Intergenic
1138350500 16:56344012-56344034 GGTCTGAGAGTGGTGGAGCCTGG - Exonic
1138984696 16:62314260-62314282 AGGTTTACAGAGATGGAGCCAGG + Intergenic
1139018889 16:62724304-62724326 TGTTTGAAAGAGAATGGGCCAGG + Intergenic
1140226179 16:73079195-73079217 GATATGAAAGTGATGGAGGCAGG - Intergenic
1142103444 16:88288275-88288297 GCTTTGTGAGAGAGGGAGCCAGG + Intergenic
1203001458 16_KI270728v1_random:167884-167906 AGTTTCCAAGAGATGGAGGCGGG + Intergenic
1203133060 16_KI270728v1_random:1704288-1704310 AGTTTCCAAGAGATGGAGACGGG + Intergenic
1203153466 16_KI270728v1_random:1856221-1856243 AGTTTCCAAGAGATGGAGGCGGG - Intergenic
1142919391 17:3171231-3171253 AGTTTGAAAAATGTGGAGCCTGG + Intergenic
1143557881 17:7673908-7673930 GGTTGGGAGTAGATGGAGCCTGG - Intronic
1144329712 17:14212658-14212680 CCTGTGACAGAGATGGAGCCCGG - Intergenic
1146568265 17:33931790-33931812 GCTCTGAAACTGATGGAGCCTGG - Intronic
1146572576 17:33965698-33965720 GGCTTGGAAGTGACGGAGCCTGG + Intronic
1146950820 17:36904901-36904923 GGATTGAAAGAGATATAGGCTGG + Intergenic
1147018345 17:37510574-37510596 GGTTTGACTGAAATAGAGCCAGG - Intronic
1147250355 17:39149567-39149589 GCTTTGACAGAGATTGAGCCAGG - Intronic
1147488622 17:40842746-40842768 GGTTTGGGAGAGATGGAGCAAGG + Intergenic
1149140014 17:53420991-53421013 ATTTTGAAAGAGACTGAGCCAGG + Intergenic
1151022577 17:70634673-70634695 GATTTGGAAGAGGTAGAGCCAGG - Intergenic
1151038741 17:70832844-70832866 GGTATGACAGAGATGGAGAGAGG + Intergenic
1152239543 17:79154269-79154291 GCTTTGAAACAGAAGGAGCTGGG - Intronic
1152897057 17:82918124-82918146 GGTATGACAGTGTTGGAGCCGGG + Intronic
1152918436 17:83053198-83053220 GGTTAGATAGGGATGGGGCCTGG - Intergenic
1153578302 18:6545156-6545178 GGTTTGAAAGAGCTGGAGGCAGG + Intronic
1156318307 18:35993101-35993123 ACTTTGCAAGAGATGGAGACAGG - Exonic
1159792498 18:72800049-72800071 ATTTTGAGAGAGATGGAGCCAGG + Intronic
1160879078 19:1311345-1311367 GGTTTGAAAGATGGGGAGCTGGG + Intergenic
1161920277 19:7260721-7260743 GGGTTGAATGAGATGGTGCAGGG - Intronic
1162004128 19:7766439-7766461 AGTCTGGAAGAGATGGAGCCAGG + Intronic
1162783059 19:13017172-13017194 GGTGAGAAAGAAAGGGAGCCGGG + Intronic
1162813368 19:13178316-13178338 ACAATGAAAGAGATGGAGCCTGG - Intergenic
1163504800 19:17699249-17699271 GATGTAAAAGAGGTGGAGCCAGG + Intergenic
1163513646 19:17750124-17750146 GGTTTGCAAGACTTGGTGCCGGG + Intronic
1163806172 19:19399210-19399232 TGTTTGTTTGAGATGGAGCCTGG - Intronic
1164144375 19:22502478-22502500 AGTTTGAAGGAGATGGAGGCTGG - Intronic
1165120011 19:33552815-33552837 GGTTGGGAAGAGATGGAGGGGGG + Intergenic
1166815290 19:45541147-45541169 GGATTGAACGAGAAGGAGCCTGG - Intronic
1168142861 19:54400927-54400949 TTTTTTAAAGAGATGGAGTCTGG - Intergenic
1168280428 19:55302574-55302596 GGTATGAGAGAGAAGGGGCCGGG + Intronic
1168562613 19:57396456-57396478 GGTGTGGAAGAGATTGAGCAAGG + Intronic
925209409 2:2033765-2033787 TGTTTGAAGGACATGGTGCCTGG + Intronic
925914103 2:8592457-8592479 GCATTCAAAGAGATGCAGCCAGG + Intergenic
926345348 2:11939927-11939949 GGTCTCAAGGAGATGGGGCCTGG - Intergenic
926577379 2:14596913-14596935 GGTTTGAGAAAGAAGAAGCCAGG + Intergenic
926701131 2:15804385-15804407 AGGCTGCAAGAGATGGAGCCAGG + Intergenic
926701821 2:15809166-15809188 GCTTTGAAAGAGGCTGAGCCAGG + Intergenic
926824667 2:16892556-16892578 ATTTTGAAAGAGACTGAGCCAGG + Intergenic
927697050 2:25245926-25245948 GGTTTGAATGACATGGGACCAGG - Intronic
927990727 2:27445135-27445157 GGTTTGAGAGAGATTGAGGAGGG + Intronic
929432661 2:41901584-41901606 GGAAAGAAAAAGATGGAGCCAGG - Intergenic
931428252 2:62190355-62190377 GGTGTGAAGGCCATGGAGCCAGG - Intergenic
932642167 2:73460196-73460218 GGGTTGAAAGAGTTGGGGCTGGG - Intronic
933284787 2:80374212-80374234 GGGTGGAAAGAGAGGAAGCCAGG - Intronic
934321204 2:91973800-91973822 AGTTTCCAAGAGATGGAGGCGGG + Intergenic
934514983 2:94980950-94980972 GGCTGGAGAGAGATGGGGCCAGG - Intergenic
935230381 2:101090707-101090729 AGATTGAAAGTGGTGGAGCCAGG - Intronic
936614192 2:114032166-114032188 GGTGTGAAAGGGATGGAAACTGG - Intergenic
937257667 2:120566428-120566450 GGTGTGACAGAGAAGGAGGCTGG + Intergenic
937680085 2:124634178-124634200 GGTTTGAAAAATTTGCAGCCTGG - Intronic
937726674 2:125175378-125175400 GGTTTGAAAAAGTTGCAGCCTGG + Intergenic
938105794 2:128528947-128528969 GGTATGAAAGTGATGTATCCGGG - Intergenic
939207097 2:139120768-139120790 AGCTTGAAAGAGATGAAGACAGG - Intergenic
940160125 2:150702673-150702695 GGTTTGAATGTGATTGAGCCGGG - Intergenic
941300583 2:163796062-163796084 AATTTTGAAGAGATGGAGCCAGG - Intergenic
944640384 2:201718627-201718649 AGTTTTAAAGAGTTGGAGACTGG - Intronic
947696648 2:232195827-232195849 GGTTTAAGAGATATGCAGCCAGG - Intronic
949006498 2:241652323-241652345 GCTGTGAAGGAGATGGAGGCTGG - Intronic
1168754639 20:307964-307986 GGTTGGAAGGAGAGGGAGCCTGG - Intergenic
1170783366 20:19447051-19447073 GTTTAGAAAGAAATGGAACCTGG + Intronic
1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG + Intergenic
1172938006 20:38634445-38634467 CGTTTGCAAGAGGTGGAGCTTGG + Intronic
1172962406 20:38807782-38807804 GGCTGGGAAGAGCTGGAGCCAGG - Intronic
1174086577 20:48012947-48012969 GGTTGGAAAGGGAGGGAGTCTGG - Intergenic
1174583076 20:51586480-51586502 AATTTGTAAGAGATGGAGCCAGG - Intergenic
1177262918 21:18752473-18752495 CTTTTGAAAGAGATGGATCATGG - Intergenic
1177273906 21:18882028-18882050 ATTTTGAAAGAGACTGAGCCAGG - Intergenic
1181776276 22:25162019-25162041 GGTTTGGAAGGGGTGGAGCTGGG - Intronic
1181992368 22:26847196-26847218 GTTTTGACAGAGAGGGATCCCGG - Intergenic
1182032460 22:27170234-27170256 AGTTTGGAAGTGATGGAGCTGGG + Intergenic
1182088749 22:27579756-27579778 GGATTGAATGAGATGGGGCTGGG + Intergenic
1182211532 22:28680788-28680810 AGTTTTCAAGAGATGGAGGCGGG - Intergenic
1183705454 22:39472692-39472714 AGCTGGAAAGAGGTGGAGCCAGG + Intronic
1184513997 22:44949378-44949400 ATTTTGAAAGAGATAGAGCCAGG - Intronic
1184701972 22:46181234-46181256 TGTGTGAAAGAGATGGTTCCGGG + Intronic
1184913294 22:47550260-47550282 GGAAGGAAAGAGAAGGAGCCGGG - Intergenic
949412792 3:3784053-3784075 GGTGTGGAAGAGATGGAGGGAGG + Intronic
949478566 3:4471775-4471797 GGTTGGAAAAACATGGGGCCTGG - Intergenic
949577403 3:5352111-5352133 TGGCTGAAAGTGATGGAGCCAGG + Intergenic
949802698 3:7920945-7920967 GTATTGGCAGAGATGGAGCCAGG - Intergenic
950758465 3:15198321-15198343 ATTTTGAAAGAGACTGAGCCAGG - Intergenic
952400782 3:32961347-32961369 GGGTGGTAAGAGATGGAGCAGGG + Intergenic
952837986 3:37620587-37620609 AGTTTGCAAGAAATGGAGCTTGG + Intronic
953600733 3:44361422-44361444 GGTTTCAAAGACTTGAAGCCTGG - Exonic
955251812 3:57290386-57290408 AGTGTGAAAGAGGGGGAGCCAGG - Intronic
955885916 3:63598228-63598250 TATTAGAAAGAGATGGAGACAGG + Intronic
957555488 3:81761173-81761195 GGTTTGACAGCGCTGGTGCCCGG - Intronic
957570384 3:81940170-81940192 GATTTGAAAGTGATGGAACTAGG - Intergenic
959077688 3:101766948-101766970 TTTTTTAAAGAGATGGAGGCTGG + Exonic
959562780 3:107801597-107801619 GGTTTGCAGGTGATGGAGCTAGG - Intronic
960103051 3:113765317-113765339 GTTCTGTAAGAGATGGGGCCAGG + Intronic
960198162 3:114796539-114796561 TAATTGAAAGAGATGGAGCAGGG - Intronic
960595292 3:119402823-119402845 GGATGGAAAGAGAAGGAGACTGG - Intronic
961326367 3:126111725-126111747 GGTTTCAGAGAGATGGTACCTGG - Intronic
961626136 3:128264938-128264960 GAGTTGAAAGACTTGGAGCCGGG - Intronic
962267270 3:133952840-133952862 GGCTAGTAAGAGATGGAGCCAGG + Intronic
962419617 3:135216393-135216415 GGTATGAAGGAGTTGGAGACAGG + Intronic
962482917 3:135813135-135813157 AATTTGAAAGAGATGGACACAGG + Intergenic
963156074 3:142098726-142098748 TGTTTTAAAGAGATGGAGTCTGG - Intronic
963527263 3:146430341-146430363 GGCTTGAAAGAGATAGGGCCAGG + Intronic
966164787 3:177005708-177005730 AGTTTGAAAGATTTGCAGCCTGG + Intergenic
966239475 3:177740414-177740436 GGCTTGAAAGAGGAGGAGACTGG + Intergenic
967188329 3:186964306-186964328 GGGTTGAAAGAGAGAGAGCGTGG - Intronic
968706952 4:2083534-2083556 GGTTTGAAATGTATGGAGTCAGG - Intronic
971532524 4:27706942-27706964 GTATTGATAGGGATGGAGCCAGG - Intergenic
972573399 4:40330469-40330491 GGTTTGAGAGAGAAGAAGCGAGG + Intergenic
973152517 4:46906122-46906144 GGATTGAAATATATGGGGCCGGG - Intronic
974058527 4:57008843-57008865 GAATTAAAAGAGATGGAGGCAGG + Intronic
974577507 4:63746095-63746117 TGTTTTTTAGAGATGGAGCCTGG - Intergenic
974658632 4:64858175-64858197 TGTTTCAAAGAGATGGCTCCCGG + Intergenic
975643827 4:76526771-76526793 GGTATGCAAGAGAGAGAGCCTGG + Intronic
976379697 4:84385082-84385104 GCTTGGAAAGAGAAGGAGACAGG + Intergenic
976456029 4:85247606-85247628 TGTTTGACAGAGATGGAGGGTGG - Intergenic
977646489 4:99418477-99418499 GTTTTAGGAGAGATGGAGCCAGG - Intronic
979092025 4:116495435-116495457 GATTAGAAAGTGATGAAGCCAGG - Intergenic
979625695 4:122842806-122842828 GGTTTAAAACTGATGAAGCCAGG - Intronic
979653938 4:123169432-123169454 AGTCTCAAAGAGATAGAGCCTGG + Intronic
980760881 4:137233065-137233087 GACTTGTAAGAGATGGAGCATGG - Intergenic
983176092 4:164589270-164589292 TGTTTAAAAAAGATGGAGCCCGG - Intergenic
985012369 4:185596872-185596894 GGTTTGAAAGATATGAAGGAAGG - Intronic
985753459 5:1697668-1697690 GTTTGGAAAGAGACTGAGCCAGG - Intergenic
985809488 5:2072704-2072726 GGTTTGAAAAACTTGCAGCCTGG + Intergenic
988136037 5:27173239-27173261 ATTTTGAAAGAGACTGAGCCAGG + Intergenic
988516741 5:31911686-31911708 GGCTTGGATGTGATGGAGCCAGG + Intronic
988778216 5:34496284-34496306 GTCCTGAAAGAGAGGGAGCCAGG - Intergenic
988789425 5:34593713-34593735 GCTCTGTAAGAGATGGAACCTGG + Intergenic
989276143 5:39591988-39592010 AGTTAGAAAGTGATAGAGCCAGG - Intergenic
993509739 5:88756860-88756882 TGTTTGTAAAAGTTGGAGCCTGG - Intronic
994215400 5:97131911-97131933 GGGTAGAGAGAGATGAAGCCTGG + Intronic
994429621 5:99641163-99641185 GGTTTGAAAGAAATGGTGTCTGG + Intergenic
994981703 5:106883006-106883028 AGTTTGCTAGAGATGGAGGCTGG - Intergenic
996284194 5:121769717-121769739 AGTTTGAAAAACATGCAGCCTGG + Intergenic
996409043 5:123136962-123136984 AGTTAGAAAGAGATGTAGCTGGG - Intronic
997718003 5:136056466-136056488 GGGTGGAGAGAGCTGGAGCCTGG + Intronic
998473742 5:142403697-142403719 TGTTTGAAAGAGGAGGAGCAGGG - Intergenic
999010865 5:148038352-148038374 GATTTGAGAGTGATGGAGGCTGG + Intronic
999538361 5:152543924-152543946 GGTTTGAAATAAATGGTGCTGGG + Intergenic
999797607 5:155002999-155003021 TTTTTTAAAGAGATGGGGCCGGG + Intergenic
1000778789 5:165453622-165453644 TGTTTGAAAAAAATGGGGCCCGG + Intergenic
1000862464 5:166472951-166472973 GGTATGGAAGAGCTGGAGGCTGG + Intergenic
1001044887 5:168364193-168364215 GTTCTGGAAGAGGTGGAGCCTGG + Intronic
1001926229 5:175639243-175639265 GGCTAGAAAGTGATGGAGCTGGG + Intergenic
1002547450 5:179959243-179959265 GGTTTGGAAGAGAGGGGACCGGG - Intronic
1003781300 6:9430136-9430158 GCTGTGAAAGAGATGGAGCGGGG - Intergenic
1004214440 6:13688580-13688602 GGATTGACAGAGATGGAGACAGG - Intronic
1005807546 6:29488581-29488603 GGTTTGAAAGAGATGAGACATGG - Intergenic
1006372904 6:33656466-33656488 TGTTTTATAGAGTTGGAGCCTGG + Intronic
1006876662 6:37303519-37303541 GGTTTGAAGGAGATAAAACCGGG - Intronic
1006934164 6:37705746-37705768 GGTTGGGAAGAGAAGGAGCGAGG - Intergenic
1007455315 6:41972600-41972622 GTTGTGACAGAGATGGCGCCTGG + Intronic
1009523620 6:64715673-64715695 ATTTTGAAAGAGACTGAGCCAGG - Intronic
1009585152 6:65591284-65591306 GGATTGATTGAGATGGAGTCAGG - Intronic
1012614505 6:101260349-101260371 ATTTTGAAAGAGACTGAGCCAGG + Intergenic
1013794573 6:113872228-113872250 AGTTTGCATGTGATGGAGCCAGG - Intergenic
1014018743 6:116564796-116564818 GAATAGAAAGAGATGGTGCCTGG + Intergenic
1014964288 6:127727855-127727877 GGTTTCAAAGAAATGGTGCCAGG - Intronic
1015549760 6:134400084-134400106 GGTTTGAGACATATGGAGCCAGG - Intergenic
1016442518 6:144098347-144098369 ATTTTGAAAGAGACTGAGCCAGG - Intergenic
1017626202 6:156351671-156351693 GGTTGGCAAGGGTTGGAGCCTGG + Intergenic
1018596512 6:165486948-165486970 ATTGTGAAAGAGATGGAGCCAGG + Intronic
1018664567 6:166123233-166123255 ATTGTGAAAGAGACGGAGCCAGG - Intergenic
1018699757 6:166416982-166417004 GGGCTGAAAGAGAAGGAGTCAGG - Intronic
1021285639 7:18777923-18777945 GATTTAAAAGAGATTGAGGCAGG - Intronic
1021405524 7:20262945-20262967 GGTCAGAGAGAGATGGAGCCTGG - Intergenic
1022326635 7:29338061-29338083 GGTTGGAAATAGATGAAGGCAGG + Intronic
1022504522 7:30902124-30902146 GGTTTGGAAGGGATGGGGCTTGG - Intergenic
1022668548 7:32433243-32433265 TGCTGGAATGAGATGGAGCCTGG - Intergenic
1023527612 7:41120986-41121008 GGTTTTAAAAAAATGGAACCAGG + Intergenic
1025167696 7:56727311-56727333 GGTTTGAGAAAGTTGGAGTCGGG - Intergenic
1025189397 7:56885113-56885135 TGTTTTAAAGAGTTGGAGTCTGG - Intergenic
1025682543 7:63691804-63691826 TGTTTTAAAGAGTTGGAGTCTGG + Intergenic
1028910169 7:96199083-96199105 GGATTCAAAGAGATGAAGCAGGG - Intronic
1029374002 7:100167115-100167137 GGTGACAGAGAGATGGAGCCAGG + Exonic
1029665205 7:101990676-101990698 TGTTTTAAAGAGATGGGGTCTGG - Intronic
1029715334 7:102322386-102322408 GGTGTGAATGAGGTGGAGCGCGG - Intergenic
1029916648 7:104216519-104216541 TGTTTGTAAGAGATGGAGGGAGG + Intergenic
1030016746 7:105230240-105230262 ACTTTGACAGAGATGGAGGCTGG + Intronic
1031286862 7:119881463-119881485 GGTTTGAAAAAAATGGAGTCAGG - Intergenic
1033818114 7:145100180-145100202 GGTTTGTAAATGCTGGAGCCAGG + Intergenic
1034485953 7:151362662-151362684 GGAGTTAAAGAGATGGAGCTGGG + Intronic
1034915139 7:155032679-155032701 TCTTTGAAAGAGATTGAGCAGGG + Intergenic
1036080930 8:5554676-5554698 GGTCTGAAAGAGAAGGAGGAAGG - Intergenic
1037023161 8:13998914-13998936 TTTTTGAAAGAGACTGAGCCAGG - Intergenic
1038992083 8:32878897-32878919 GGTCTGAAAGAGGAGGAGCAGGG - Intergenic
1039856549 8:41420214-41420236 GGTTTGAAAGCGGCAGAGCCAGG + Intergenic
1044305859 8:90640134-90640156 GTTTTGAAAGAGTTGGAGTCTGG - Intronic
1045283626 8:100771396-100771418 CATTTGAGAGAGATGGGGCCAGG + Intergenic
1046238099 8:111453738-111453760 ATTTTGAAAGAGAATGAGCCAGG + Intergenic
1046498310 8:115042870-115042892 GGTTTGAAAGACATGGACACAGG - Intergenic
1046618533 8:116502922-116502944 GTTTAGCAAGGGATGGAGCCTGG - Intergenic
1047263890 8:123287340-123287362 GGTTAAAAACAGATGGGGCCGGG - Intergenic
1048029262 8:130615677-130615699 GCAGTGGAAGAGATGGAGCCCGG - Intergenic
1048377610 8:133836238-133836260 TATTTGAAAAAGATGGGGCCTGG - Intergenic
1050318434 9:4426714-4426736 AGCAAGAAAGAGATGGAGCCAGG - Intergenic
1050474941 9:6031378-6031400 GGGTTGGAAGATATGGAACCAGG - Intergenic
1050608429 9:7325953-7325975 GGTTTGCAAAATATGGAGCCGGG + Intergenic
1052128070 9:24803710-24803732 TGTTTGTAATAGATGGAGACTGG - Intergenic
1056342006 9:85645052-85645074 AGTTTATAAGAGGTGGAGCCAGG - Intronic
1056938946 9:90938625-90938647 GGTTAGAAAGAGATGAATTCTGG - Intergenic
1057712075 9:97454838-97454860 GAATTGAAGGAGATGGAGACAGG + Intronic
1057775798 9:98008284-98008306 TTTTTGAAAGAGAGTGAGCCAGG + Intronic
1058229254 9:102405961-102405983 ATTTTGAAAGAGACAGAGCCAGG + Intergenic
1058632940 9:107008071-107008093 GATTTGAAAGAGAAGAATCCAGG + Intronic
1059915435 9:119094502-119094524 AGTTAGTAAAAGATGGAGCCAGG - Intergenic
1060193938 9:121610828-121610850 GGGTGGAAAGAGATGGGCCCAGG - Intronic
1060723223 9:125991833-125991855 GCTTTGAAAGAGACAGAGCCAGG - Intergenic
1060834436 9:126744507-126744529 GGTTTTAAGTAGCTGGAGCCTGG + Intergenic
1061571163 9:131478176-131478198 GGCTTTAAAGAGAGGAAGCCTGG + Intronic
1061791205 9:133060076-133060098 GCTTTGGAAGAGACAGAGCCAGG + Intergenic
1061793873 9:133072197-133072219 GCTTTGGAAGAGACAGAGCCAGG + Intronic
1062219396 9:135406373-135406395 GGTTTGCCAGGGATGGAGTCAGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188224140 X:27575617-27575639 GATTTGAAATATATGAAGCCAGG + Intergenic
1190300444 X:49054011-49054033 GGTTTAAAAAAGATGTAGTCAGG - Intronic
1192202521 X:69075766-69075788 AGTTTGACAGAGATGCAGCCAGG + Intergenic
1192305815 X:69958414-69958436 GCTATTAAAGAGATGGAGCCAGG + Intronic
1194517588 X:94875666-94875688 GGTTTGAAAGAACGTGAGCCAGG - Intergenic
1195634858 X:107102640-107102662 GGTGTGAAAGAGACAGAGACAGG + Intronic
1195697921 X:107680328-107680350 GGTTTGGAAGACAGAGAGCCAGG - Intergenic
1196455831 X:115891034-115891056 GGTGTGAAAGCGAGGGAACCAGG + Intergenic
1198081388 X:133243172-133243194 CTTTTTAAAGAGATGGAGCCAGG - Intergenic
1198707851 X:139468605-139468627 GATTTGGAAGAGATAGAGCATGG + Intergenic