ID: 1068025982 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:51644733-51644755 |
| Sequence | CTAGGGTTGTCCATTGCTAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1068025976_1068025982 | 28 | Left | 1068025976 | 10:51644682-51644704 | CCTTAATTCCTTTCAGAAGGAAA | No data | ||
| Right | 1068025982 | 10:51644733-51644755 | CTAGGGTTGTCCATTGCTACTGG | No data | ||||
| 1068025975_1068025982 | 29 | Left | 1068025975 | 10:51644681-51644703 | CCCTTAATTCCTTTCAGAAGGAA | No data | ||
| Right | 1068025982 | 10:51644733-51644755 | CTAGGGTTGTCCATTGCTACTGG | No data | ||||
| 1068025977_1068025982 | 20 | Left | 1068025977 | 10:51644690-51644712 | CCTTTCAGAAGGAAATAGTGTTT | No data | ||
| Right | 1068025982 | 10:51644733-51644755 | CTAGGGTTGTCCATTGCTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1068025982 | Original CRISPR | CTAGGGTTGTCCATTGCTAC TGG | Intronic | ||