ID: 1068025982

View in Genome Browser
Species Human (GRCh38)
Location 10:51644733-51644755
Sequence CTAGGGTTGTCCATTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068025976_1068025982 28 Left 1068025976 10:51644682-51644704 CCTTAATTCCTTTCAGAAGGAAA No data
Right 1068025982 10:51644733-51644755 CTAGGGTTGTCCATTGCTACTGG No data
1068025975_1068025982 29 Left 1068025975 10:51644681-51644703 CCCTTAATTCCTTTCAGAAGGAA No data
Right 1068025982 10:51644733-51644755 CTAGGGTTGTCCATTGCTACTGG No data
1068025977_1068025982 20 Left 1068025977 10:51644690-51644712 CCTTTCAGAAGGAAATAGTGTTT No data
Right 1068025982 10:51644733-51644755 CTAGGGTTGTCCATTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068025982 Original CRISPR CTAGGGTTGTCCATTGCTAC TGG Intronic