ID: 1068026980

View in Genome Browser
Species Human (GRCh38)
Location 10:51658358-51658380
Sequence CAGGATTACCATAATAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068026972_1068026980 27 Left 1068026972 10:51658308-51658330 CCCAATGCAGAAAGAAGGCAGTC 0: 1
1: 0
2: 2
3: 18
4: 215
Right 1068026980 10:51658358-51658380 CAGGATTACCATAATAGGGCAGG No data
1068026973_1068026980 26 Left 1068026973 10:51658309-51658331 CCAATGCAGAAAGAAGGCAGTCA 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1068026980 10:51658358-51658380 CAGGATTACCATAATAGGGCAGG No data
1068026971_1068026980 30 Left 1068026971 10:51658305-51658327 CCACCCAATGCAGAAAGAAGGCA 0: 1
1: 0
2: 0
3: 22
4: 262
Right 1068026980 10:51658358-51658380 CAGGATTACCATAATAGGGCAGG No data
1068026974_1068026980 3 Left 1068026974 10:51658332-51658354 CCTAGATTAAAATACTCCTTTCT 0: 1
1: 0
2: 1
3: 31
4: 395
Right 1068026980 10:51658358-51658380 CAGGATTACCATAATAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068026980 Original CRISPR CAGGATTACCATAATAGGGC AGG Intronic
No off target data available for this crispr