ID: 1068028334

View in Genome Browser
Species Human (GRCh38)
Location 10:51677019-51677041
Sequence TTATTGGGAGGGCACATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068028334 Original CRISPR TTATTGGGAGGGCACATACA GGG (reversed) Intronic
902683078 1:18057508-18057530 CTATTGGTTGGGCACAGACATGG + Intergenic
905925188 1:41744679-41744701 TTATAGGGTGGGCTCATTCAAGG + Intronic
908000261 1:59672359-59672381 TTAATGAGAGGGCACACACTTGG - Intronic
910020902 1:82588370-82588392 TAATTGGGAGGCAGCATACAGGG - Intergenic
911769938 1:101727819-101727841 TTATTCTGAGGGGAAATACAGGG + Intergenic
918866777 1:189910429-189910451 TTATAGGGAGCTTACATACAGGG - Intergenic
919114900 1:193268920-193268942 TTATGAGGAGGGTAGATACAGGG + Intergenic
919600656 1:199618259-199618281 TTATTAGGTGGCTACATACAGGG - Intergenic
1063901765 10:10740571-10740593 TTTTTGGGAGGGCGGGTACATGG - Intergenic
1064054711 10:12087665-12087687 TTATTGGGATGCCCCATAGAGGG + Exonic
1064422827 10:15205092-15205114 TTATTGGGGGCTTACATACAGGG - Intergenic
1068028334 10:51677019-51677041 TTATTGGGAGGGCACATACAGGG - Intronic
1078370876 11:10743967-10743989 TTATTAGGGGCTCACATACAGGG - Intergenic
1079894186 11:26098139-26098161 TTATTGGGGGTTTACATACAGGG + Intergenic
1079926091 11:26493459-26493481 TTATTTGGAGGCCAAACACAAGG - Intronic
1085189545 11:74606986-74607008 CTATTGGGAGGGCAGGTCCAGGG - Intronic
1085472081 11:76764876-76764898 TTATTGGGGGAGTACATTCAAGG + Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1094207067 12:27851773-27851795 TTATTGGGAGCTTACATACAAGG - Intergenic
1095234608 12:39781816-39781838 TTAGTGGGTGGGCTCATATACGG + Intronic
1096086182 12:48866533-48866555 ATATTGGGAGGGGAAATAAAGGG - Intergenic
1096765309 12:53883153-53883175 AGATTGGAAGGGCTCATACAGGG - Intergenic
1102713777 12:114952425-114952447 TTCTAAGGAGGGCACATAGAGGG - Intergenic
1106088297 13:26562508-26562530 TTATAGGGAGGGCAGATAAAGGG + Intronic
1109430865 13:62233055-62233077 TTATTGTGATTGCACATATAAGG + Intergenic
1116576152 14:46578277-46578299 TTATTGTGAGTGCAAATACCTGG + Intergenic
1119941294 14:78644236-78644258 TTTTTGGGTGGGCAATTACAGGG + Intronic
1125178066 15:36848288-36848310 TTATTGGGAGGGTTCAATCAAGG - Intergenic
1125886547 15:43234044-43234066 ATTTTGGGAAGGCAAATACATGG - Intronic
1128626357 15:69209674-69209696 TTACTGGGAGATCACAGACAAGG - Intronic
1130194948 15:81771016-81771038 TTATTGTTAGGTAACATACATGG - Intergenic
1131498929 15:92941373-92941395 TTACTGGGAGACAACATACAGGG + Intronic
1131666386 15:94575851-94575873 TTATTAGGAGCTTACATACAGGG + Intergenic
1131690939 15:94826547-94826569 TGATGTGGAGGGCACATAAAAGG - Intergenic
1135009589 16:18862921-18862943 TTCTTGGGAGGGAAGACACAAGG - Intronic
1137337653 16:47566167-47566189 GTATTGGGATGGCCCATGCAGGG - Intronic
1138838968 16:60474440-60474462 TTATTAGGGGCTCACATACAGGG - Intergenic
1140618614 16:76698713-76698735 TTCGTGGGAGGGTAGATACATGG - Intergenic
1140776174 16:78250645-78250667 TTATTAGGAGGTTACATATAGGG + Intronic
1145008093 17:19349051-19349073 CTTTTGGGAGGGAACATACATGG - Intronic
1146381641 17:32333880-32333902 TGATTGGGAAGGGGCATACAGGG - Intronic
1146709852 17:35031614-35031636 TTATTGGGAGGCTACACAGAGGG + Intronic
1149944931 17:60914446-60914468 GTATTGGAAGGAAACATACAGGG + Intronic
1151443159 17:74146787-74146809 TCATGGGGAGGGCACAGAGATGG - Intergenic
1164289699 19:23856203-23856225 TCATTAGGATGGCACTTACAAGG + Intergenic
925768623 2:7261207-7261229 TTAGTGGGAGGGGACAGAGAAGG + Intergenic
926540116 2:14165726-14165748 CCATTGGGTGTGCACATACAGGG + Intergenic
930051173 2:47217366-47217388 TTATTAGGGGGTTACATACAGGG - Intergenic
930339987 2:50100213-50100235 TTCTTGGGAAGAAACATACATGG - Intronic
935233491 2:101119001-101119023 TTTTTGGGGGGGCAGAGACAGGG - Intronic
935633394 2:105231018-105231040 TTATTGAGAGGGCAGATTCTGGG - Intergenic
936666369 2:114601185-114601207 GTAATGGGTGGGCACATCCATGG + Intronic
937041861 2:118828382-118828404 TTATTGGGGAAACACATACATGG - Intergenic
941352322 2:164451981-164452003 TAATTGGGAAGGCAAACACAAGG - Intergenic
941688666 2:168474892-168474914 TTATTAGGAAGCCCCATACAAGG - Intronic
942437432 2:175995745-175995767 TTATTTGGATGCCACATATATGG + Intronic
943294575 2:186120589-186120611 TTAATGAGAAGGCAGATACAAGG - Intergenic
943571791 2:189582026-189582048 TGATTGAGAGTGCAGATACAGGG - Intronic
1169753730 20:9021985-9022007 TTCTTGGGAGAGCACAAACTTGG - Intergenic
1170385953 20:15817396-15817418 TTTTTTGGTGGGCACATTCAGGG - Intronic
1173699408 20:45054882-45054904 TTAATGAGAGGGCAGATTCAGGG - Intronic
1177795069 21:25767189-25767211 TGATTGGGAGGGGACATAAAGGG + Intronic
1180186312 21:46141317-46141339 TTTTTGGGTGGGTAAATACAGGG + Intronic
1183044600 22:35209758-35209780 TTCTTGGGAGGGCTCAGAAAAGG - Intergenic
1184804058 22:46781116-46781138 AAATTGGGAGGGCACCTCCAGGG - Intronic
949411451 3:3769549-3769571 TTATAGGGAGGGAACATGCATGG - Intronic
954235531 3:49254430-49254452 ATGATGGTAGGGCACATACACGG + Intronic
954644035 3:52119874-52119896 TTATTGGGAAGGCCAGTACATGG + Intronic
955334710 3:58075693-58075715 TTATTGGGAGGGTATAGAAAAGG + Intronic
957707465 3:83807536-83807558 TTATTGGGAAATCTCATACAAGG - Intergenic
958014339 3:87920580-87920602 TTATTGGAAAGGAACATAAAAGG + Intergenic
958872758 3:99580388-99580410 TCATTGCCAGGGGACATACATGG - Intergenic
958932045 3:100217621-100217643 TTATTGGGCTGGCACATAAGGGG - Intergenic
960621430 3:119640426-119640448 TTATTGGGAGAGTACCTTCAGGG + Intronic
962492895 3:135910868-135910890 GTATTTGGATGTCACATACATGG - Intergenic
964057376 3:152477797-152477819 TTAATGGGAGGGCACTAGCAAGG + Intergenic
964760634 3:160132401-160132423 TTACTGGGAGCTTACATACAGGG + Intergenic
975558522 4:75688080-75688102 TTATTAGGGGGTTACATACAGGG - Intronic
976188026 4:82462544-82462566 TTATTGCCAGGGCAGATGCACGG + Intergenic
978746613 4:112201958-112201980 TTATTGGGGGCTTACATACAGGG + Intergenic
981893073 4:149762441-149762463 TTATTGGTAGGGAAAATAGAGGG + Intergenic
982093617 4:151900454-151900476 TTATTGGGGGTTTACATACAGGG + Intergenic
985649653 5:1101458-1101480 CTATTGGGAGGGCTCCTCCAAGG - Intronic
986591482 5:9375195-9375217 CTTTTGGGAGGACACATAAAAGG - Intronic
993968650 5:94389331-94389353 TTACTGGGAGCTTACATACAGGG - Intronic
1002574587 5:180166366-180166388 ATACTGGAAGGACACATACATGG - Intronic
1005163125 6:22888366-22888388 GTATTGGCAGGGCACATCCCAGG - Intergenic
1008475033 6:51927346-51927368 TTATAGGGAAGCCACAGACAGGG + Intronic
1008489745 6:52074041-52074063 TTATTTGGAAGGCACATACTTGG - Intronic
1008495847 6:52133462-52133484 GTATTTGCAGGGCACACACAGGG - Intergenic
1015960899 6:138648540-138648562 TTAGTGGGAGGTCACATGAATGG - Intronic
1016264818 6:142220381-142220403 CAATTGGGAGAGCACATAGAGGG + Exonic
1017717104 6:157220655-157220677 GTATTGGGTGGGCACAGTCATGG + Intergenic
1019877874 7:3831064-3831086 ATTTTTGGAGGGCACAAACAAGG + Intronic
1019931483 7:4226222-4226244 GTATTGGGAGGGGCCACACAGGG + Intronic
1020365284 7:7374154-7374176 TTATTGGGACGGCATCCACAGGG - Intronic
1022568555 7:31428267-31428289 TTATTGGGGGCTTACATACAGGG + Intergenic
1025217112 7:57067481-57067503 TTAAAAGGAGGGCACAGACATGG + Intergenic
1025628035 7:63241122-63241144 TTAAAAGGAGGGCACAGACATGG + Intergenic
1025654233 7:63502982-63503004 TTAAAAGGAGGGCACAGACATGG - Intergenic
1028562999 7:92196091-92196113 TCATTGGAAGGGCACCCACATGG - Intergenic
1036394966 8:8361640-8361662 GTATTGGATGGGGACATACAAGG + Intronic
1041529403 8:58846885-58846907 GTTCTGGGAGGTCACATACAAGG - Intronic
1047805118 8:128351350-128351372 TTCTTGGAAGGGTACCTACAAGG + Intergenic
1051669427 9:19494940-19494962 TTATTAGGGGCTCACATACAGGG + Intergenic
1055359442 9:75473937-75473959 TTTTAGGGAGGGCACAGACATGG + Intergenic
1057541738 9:95979768-95979790 TTTTTCAGATGGCACATACAAGG - Intronic
1059519317 9:114925110-114925132 TTATTGGGGGCTTACATACAGGG + Intronic
1186861523 X:13677330-13677352 TGTTTGGGAGGAGACATACAGGG - Intronic
1187846819 X:23547239-23547261 TTGTTGTGATGGCAAATACAAGG - Intergenic
1190092597 X:47452488-47452510 TTGTAGGGAGGGCACAACCATGG - Intronic
1190320354 X:49176291-49176313 CCAGTGGGAGGGCAGATACAAGG - Intronic
1194665728 X:96675584-96675606 TTATTGTAGGGCCACATACAGGG + Intergenic
1196776316 X:119341131-119341153 ATAATGGGAGGGCACAGACAAGG - Intergenic
1200853579 Y:7911625-7911647 TTATTGGTGGGGCACAAAGAAGG + Intergenic
1202266102 Y:23020912-23020934 TTATTGGTGGGGCACAAAGAAGG - Intergenic
1202419095 Y:24654655-24654677 TTATTGGTGGGGCACAAAGAAGG - Intergenic
1202451691 Y:25015429-25015451 TTATTGGTGGGGCACAAAGAAGG + Intergenic