ID: 1068030777

View in Genome Browser
Species Human (GRCh38)
Location 10:51702241-51702263
Sequence CAGTGGGACTAAAGAGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068030777_1068030780 -4 Left 1068030777 10:51702241-51702263 CCATGTTCTCTTTAGTCCCACTG 0: 1
1: 1
2: 0
3: 21
4: 255
Right 1068030780 10:51702260-51702282 ACTGTTCCAAACTAGAAGAATGG No data
1068030777_1068030782 21 Left 1068030777 10:51702241-51702263 CCATGTTCTCTTTAGTCCCACTG 0: 1
1: 1
2: 0
3: 21
4: 255
Right 1068030782 10:51702285-51702307 TGTCATGCCCCCGTTCATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068030777 Original CRISPR CAGTGGGACTAAAGAGAACA TGG (reversed) Intronic
901189556 1:7400406-7400428 CAGTGAGGTAAAAGAGAACATGG - Intronic
901272397 1:7962487-7962509 AAGTTGGATTTAAGAGAACATGG + Intronic
905750402 1:40457588-40457610 CAGAGAGACTAATGAGAAGATGG - Intronic
907271715 1:53295232-53295254 CTGTGGGAGTGAAGAGAGCAGGG + Intronic
907570501 1:55478694-55478716 GAGTGGGAATAAACAGACCAAGG - Intergenic
908912164 1:69084668-69084690 CAATGGGACTGAATAGAGCAAGG - Intergenic
909431326 1:75590630-75590652 CCGTGGGCCTTAAGGGAACATGG + Intronic
909688463 1:78377608-78377630 CAATGGGAATAAAGAGGAAAGGG - Intronic
909725323 1:78828160-78828182 CAGTAGGGCAAAAGAGATCAGGG - Intergenic
910202057 1:84709814-84709836 CAGTGTGAGTAATGAGAGCACGG + Intergenic
911804947 1:102194414-102194436 ATGTGGGACTAAAGAGTTCATGG + Intergenic
912468545 1:109890830-109890852 CAGTGGGAATAAATAGAAAGAGG - Intergenic
912799467 1:112712084-112712106 GAGTGGGTCTGAAGAGAACCAGG - Intronic
915977345 1:160400187-160400209 CCGTGGCCCTAAAGAGAATATGG + Intergenic
916122648 1:161542530-161542552 CAGTGGGACCAATGAAAGCATGG - Exonic
916132547 1:161623968-161623990 CAGTGGGACCAATGAAAGCATGG - Exonic
916161963 1:161925937-161925959 AAGTTGGACTAAAGTGCACATGG + Intronic
916946028 1:169728280-169728302 CAGTGGAACTAGAGAGTACTTGG + Intronic
918338896 1:183550860-183550882 CATTGGGACTCCAGATAACAGGG + Exonic
918780614 1:188695214-188695236 AAGGGGGACTAAAGAGAAGTAGG - Intergenic
920206408 1:204295568-204295590 TAGTGGGCCCCAAGAGAACAAGG - Intronic
920615216 1:207485857-207485879 CAAGGGGGATAAAGAGAACAGGG + Intronic
921036067 1:211379304-211379326 AAGGGGGACAAGAGAGAACATGG + Intergenic
921418657 1:214920637-214920659 CAATGGGACAAAGGAGACCAAGG + Intergenic
922358973 1:224803650-224803672 AAGTGGGACTACAGAAAATAGGG - Intergenic
923911592 1:238452344-238452366 CAGTGGGGCTAAGGAAAAAAAGG - Intergenic
924746542 1:246839823-246839845 CAGTTGTACTGTAGAGAACAGGG + Exonic
1063042810 10:2360178-2360200 CAGTTTGTCTAAAGAGATCAGGG - Intergenic
1067510563 10:46891597-46891619 GAGTGTGAGAAAAGAGAACAGGG - Intergenic
1067651691 10:48160265-48160287 GAGTGTGAGAAAAGAGAACAGGG + Intronic
1067781944 10:49214089-49214111 CAGGGGGCCTAAAGGGAAAATGG - Intergenic
1068030777 10:51702241-51702263 CAGTGGGACTAAAGAGAACATGG - Intronic
1068796447 10:61086430-61086452 CTTTGGAACTAATGAGAACAAGG - Intergenic
1073647141 10:105316894-105316916 CAGGGGCAGTAAAGAGGACAGGG + Intergenic
1074298741 10:112214175-112214197 CACTGGGAATTAAGACAACACGG + Intronic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1075017613 10:118921832-118921854 TAGTGGGCCTAGAAAGAACAAGG + Intergenic
1075356239 10:121779475-121779497 CAGTGGGAGTGAAGATAAAACGG - Intronic
1075951418 10:126481006-126481028 CAGTGGGACTGCAGAGCAGAGGG - Intronic
1076161686 10:128248452-128248474 AAGTGGGACTAAAGCCAACAAGG - Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1078568808 11:12439941-12439963 CGATGGGAATAAAGAGAACCAGG - Intronic
1078841498 11:15079782-15079804 CTATGGGAATAAAGAGAAGAAGG + Intronic
1078977645 11:16496292-16496314 CAATGAGACACAAGAGAACATGG + Intronic
1079118234 11:17654215-17654237 CAGTGGGACAACTGAGAAAAAGG - Intergenic
1080084860 11:28267248-28267270 CAGAGCGACCAAAGTGAACAAGG - Intronic
1080595453 11:33770150-33770172 CATTGGGAGGAAAAAGAACAGGG - Intronic
1081955120 11:47085353-47085375 CATTGGGAGCAAAAAGAACAAGG + Intronic
1084344615 11:68537917-68537939 GAGTGGGACTAAAGTGAAGTGGG + Intronic
1085558631 11:77449322-77449344 CAGTGCGCTTAAAGAGAAAAGGG + Intronic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1089319387 11:117614625-117614647 CTGTGGGACTTAAGAAACCAAGG + Intronic
1089988515 11:122836051-122836073 AAGTGGGGGTAATGAGAACAGGG + Intergenic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1091102501 11:132888090-132888112 AAGGGGGAATAAAGAGAAGAGGG + Intronic
1092168320 12:6356843-6356865 GAGGAGGACTAAAGAGAAGAGGG + Intronic
1092946663 12:13462310-13462332 CAGTGGGACAAATGAGTAAAAGG + Intergenic
1092950071 12:13494083-13494105 CAGTGAGAATATAGAGAAAAGGG - Intergenic
1096038143 12:48491007-48491029 CAGGGGAAGAAAAGAGAACATGG - Intronic
1096828059 12:54294520-54294542 CAGAGGGACTGAAGAGGAGAAGG - Intronic
1098601341 12:72334893-72334915 CAGGGGGACGGAAGAGAGCATGG + Intronic
1098958766 12:76715983-76716005 CACTGAGACAAAAGAGAAAACGG + Intergenic
1099773542 12:87095749-87095771 CAGTGATTCTAAAGATAACATGG - Intergenic
1099846756 12:88036529-88036551 AGCTGGGACTAAAGATAACAGGG - Intronic
1100397372 12:94196793-94196815 CAGGAGGACTAAATGGAACATGG - Intronic
1100726984 12:97419068-97419090 CAGTGGTTCTCAAGAGGACAGGG + Intergenic
1102755809 12:115339271-115339293 CAGTCGGTCTAGAGAGGACAAGG - Intergenic
1103482307 12:121258765-121258787 GAATGAGAATAAAGAGAACATGG - Intronic
1103810704 12:123611314-123611336 CAATGGGACAGAACAGAACAGGG - Intronic
1107402482 13:40083061-40083083 TAGTGAGCCTAGAGAGAACATGG + Intergenic
1108893104 13:55287197-55287219 CAATGGGACTAAGCAGGACATGG + Intergenic
1110812952 13:79830545-79830567 CAGTGGGTCTAAGAAGTACAGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113453045 13:110425871-110425893 CGGTGGGACTAAAGATCTCATGG - Intronic
1114619262 14:24085250-24085272 GAGTAGGAAAAAAGAGAACAGGG + Intronic
1115424304 14:33238387-33238409 CTGTGGGACTACAGAGAGAATGG - Intronic
1115738458 14:36361256-36361278 GAGTGAGAGTAAAGAGAGCAGGG - Intergenic
1115992570 14:39164991-39165013 CAGGGAGACAGAAGAGAACATGG - Intronic
1117732359 14:58736204-58736226 TAGTAGGAATAAAAAGAACAGGG + Intergenic
1118118940 14:62814512-62814534 CATGGGGACTAAAAAGATCATGG - Intronic
1118363202 14:65072877-65072899 CACAGTGACTAAAGAGAGCAAGG - Intronic
1118920012 14:70141608-70141630 CAGTAGGACAAAAGAGTTCATGG + Intronic
1119493075 14:75053688-75053710 CAGTGAGATTGAAGAAAACAAGG + Intronic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1120035140 14:79688064-79688086 AAGTGGGACCAAATAGAATATGG + Intronic
1120754474 14:88229363-88229385 AAGTGGGTCTAAGGAGAACCAGG - Intronic
1124682893 15:31751421-31751443 CAGTGAGGCTACAGAGAAAAGGG + Intronic
1126567593 15:50115960-50115982 CAGAGAGACAAAAGGGAACAAGG - Intronic
1128523260 15:68389492-68389514 CAGAGGGACTAGAGAGATCTGGG + Intronic
1129716522 15:77854901-77854923 CAGTGGGACCACAGAGATAAAGG - Intergenic
1132348682 15:101123780-101123802 CAGAGGGACAAAAGCGAAGATGG - Intergenic
1133931220 16:10233598-10233620 GATTGGGACTAAAGGGAGCATGG + Intergenic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1137582058 16:49639583-49639605 CAGTGGGAACAAAGAAAACAAGG - Intronic
1139645209 16:68324408-68324430 CAGTTGGAAAAAGGAGAACATGG + Intronic
1141753832 16:85978101-85978123 CTGTGGCACTAAAGAGAAAGCGG - Intergenic
1143037407 17:4007322-4007344 CAGAGGGAGTAGAGAAAACAGGG + Intronic
1143842168 17:9741476-9741498 CAGTGGAAATAAGGAGAGCAAGG - Intergenic
1144737032 17:17560989-17561011 CAGTGTGACTGAAGATAGCAAGG + Intronic
1145939337 17:28734332-28734354 CACTGGGACCAGAGAGGACAAGG - Intronic
1147595042 17:41711690-41711712 CAGAGGGCCTAAGGAGAAGAAGG + Intergenic
1148857674 17:50587636-50587658 CAGGGAGACTAGAGAGAGCAAGG + Intronic
1150963886 17:69945850-69945872 CATAGGAAATAAAGAGAACAGGG - Intergenic
1153435012 18:5059521-5059543 CACTGGGACTAACGATAGCAGGG - Intergenic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1153897142 18:9574867-9574889 CAGGGAGAATTAAGAGAACATGG + Intronic
1153950038 18:10050778-10050800 CAGTGGTCCTAGAGATAACATGG + Intergenic
1156450249 18:37262666-37262688 CAGTGGGAGAAAAGATATCAGGG + Intronic
1158129551 18:54137894-54137916 TTGTGGGGCTAAAGAGAAAAAGG - Intergenic
1158178895 18:54689482-54689504 CAGTAGGACTTCAGAGAGCAAGG - Intergenic
1158615898 18:58986858-58986880 AAGGGGGACTAGAGAGAACTGGG + Intergenic
1158685014 18:59605611-59605633 CAGGGGAACTAAAGATGACAAGG + Intronic
1164124744 19:22302706-22302728 CAGTGGATCTAAACAGAACTTGG - Intronic
1165417360 19:35702974-35702996 GAGTGGGACAAGAGAGAAAAGGG + Intergenic
1165556590 19:36637990-36638012 CAGTGGGATTAAAGAGTATCTGG - Exonic
1165583817 19:36894512-36894534 CAGTGGGAAACAATAGAACATGG + Intronic
1168104479 19:54158302-54158324 CAGAGGCAATAAAGAGTACAAGG - Exonic
1168181771 19:54666603-54666625 CAGTGGCACTAATGGGAACAGGG + Intronic
929862013 2:45686413-45686435 CACTTGGACAAAAGAGAAAAAGG + Intronic
930370430 2:50494461-50494483 CAGAGGGAATAAAGAGAAAGAGG + Intronic
930897616 2:56464093-56464115 CACTGGGCCAAAAGAGAGCAGGG + Intergenic
931243712 2:60475803-60475825 CAGTGGGAATACATAGAGCAAGG - Intronic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
932439948 2:71728173-71728195 CAATGGGAGGAAAAAGAACAAGG + Intergenic
934685104 2:96315425-96315447 CTGTGGGACTTGAGAGAGCAAGG + Intergenic
934981768 2:98849088-98849110 CAGTGGGGCTCAAGAGAAGCTGG + Intronic
937134534 2:119541562-119541584 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
938580916 2:132645905-132645927 CACAGGAACAAAAGAGAACACGG + Exonic
939121962 2:138127664-138127686 CACTGGGATGAAAGAAAACAAGG - Intergenic
939833413 2:147099723-147099745 CAGTGTGGCTAAAGAGGAAAAGG - Intergenic
941118454 2:161499902-161499924 CAGTTGTACTGTAGAGAACAGGG + Intronic
941286025 2:163613170-163613192 CAATGGGAAAAAGGAGAACAGGG - Intronic
944272898 2:197804022-197804044 CAGTGTGAGTAAATATAACAAGG - Intergenic
945437758 2:209839054-209839076 AAGTGGGAGGAAAGAGATCAAGG - Intronic
945518933 2:210799113-210799135 CTGTGTGAGAAAAGAGAACAAGG - Intergenic
945932261 2:215866759-215866781 CAGTGGGACGACAGAAAGCAGGG + Intergenic
948090733 2:235292691-235292713 AAGGGGGACCAAAGAGGACAGGG - Intergenic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
1171887784 20:30672147-30672169 AATTGGGACCAAAGAGAACAAGG - Intergenic
1172098675 20:32473155-32473177 CAGTGGGGCTGAAGGGACCATGG - Intronic
1172912456 20:38420101-38420123 CAGTGGGAGTAGGGTGAACATGG - Intergenic
1173324543 20:42020532-42020554 CAGAGGGACACAAAAGAACAAGG + Intergenic
1174530346 20:51207510-51207532 CACTGAGACTCAAGAGAAAATGG - Intergenic
1176897934 21:14405270-14405292 CAGTGGGACTCAAGTTATCAAGG + Intergenic
1177508721 21:22053730-22053752 CACTAGGACTAAAGGAAACACGG - Intergenic
1178898086 21:36577064-36577086 CAGTTGGACAGAAAAGAACAGGG + Intergenic
1178923411 21:36755553-36755575 CAGTGGGAATGACGTGAACATGG - Intronic
1184173768 22:42774609-42774631 CAGTGGCACCCAGGAGAACAGGG - Intergenic
950951138 3:17000564-17000586 GAGGGGGAATAAAGAGAAGATGG - Intronic
953026745 3:39149716-39149738 CAGCTGGAGTAAAGAGAGCAAGG - Intronic
953606423 3:44415852-44415874 CAGTGGGACAGCAGAGAACTTGG + Intergenic
953629443 3:44600563-44600585 GAGAGGGACTTCAGAGAACATGG - Intronic
953740496 3:45534540-45534562 CAGAATGACTAAAGAAAACATGG + Intronic
953872804 3:46642132-46642154 CTGTGGGACAAAAGAGAGAAGGG + Intergenic
955065116 3:55527126-55527148 CAGTTGGATTAAAGAGCCCAAGG - Intronic
956410368 3:68972699-68972721 CAGTAAGCCGAAAGAGAACAAGG + Intergenic
957242122 3:77672952-77672974 CACTGGGAATAATGATAACAGGG - Intergenic
958121073 3:89289282-89289304 CAGTGGGAATAAAGAGTAAAAGG - Intronic
958551211 3:95615846-95615868 CAGTGGGACAAAGGAGAATATGG + Intergenic
960906734 3:122609124-122609146 AAGTGGGAGTGAGGAGAACATGG + Intronic
962045242 3:131752105-131752127 CATTGGGATTAAAGATCACATGG - Intronic
965978355 3:174654642-174654664 CATTTGCACTAAAGAAAACATGG - Intronic
967604412 3:191427230-191427252 CAGTGAGACACAAGAGGACAAGG - Intergenic
967921952 3:194620360-194620382 CTCTGAGACTTAAGAGAACAAGG + Intronic
967936130 3:194729193-194729215 CAATGAGAATAAAGAGAGCAAGG - Intergenic
969672443 4:8597288-8597310 CAGTGTGGCTAAAGACAACTGGG - Intronic
970121661 4:12760505-12760527 CAGTGGAAAGAAAGATAACATGG + Intergenic
970186987 4:13466552-13466574 CAGTGAGAATATAGAGAAAAGGG + Intronic
970464286 4:16307476-16307498 CAGTAGGAGAAAGGAGAACAGGG - Intergenic
971479284 4:27099778-27099800 CAGTGGCACCAATGAGATCACGG - Intergenic
971866779 4:32182896-32182918 AAGTGGAATGAAAGAGAACATGG - Intergenic
972112000 4:35574128-35574150 TAGATGGAATAAAGAGAACATGG - Intergenic
974542416 4:63254869-63254891 AAGTGGCACTAAGGAGAACTAGG + Intergenic
975378571 4:73672332-73672354 CATTGTCACTAAAGAGCACATGG + Intergenic
975657397 4:76655304-76655326 CACTGTGTCTAAAGAGAACATGG - Intronic
976291227 4:83420330-83420352 CAGTGGCAATCAAGAGAATATGG + Intronic
976616945 4:87087626-87087648 TAGAGGGACTTAAGAGAACTGGG - Intronic
978462468 4:108971567-108971589 CAGTGTGTCTGAAGAGGACATGG + Intronic
978768408 4:112428982-112429004 AAGTGGGTCTAAAGACCACAAGG - Intronic
981122848 4:141072456-141072478 CAGTGGGACAAAAGGAAAAAAGG + Intronic
982048190 4:151470682-151470704 CAATGAGAATAAAGAGAAGAGGG + Intronic
982524788 4:156465233-156465255 CATTAGTACTAAAGAGAAAAAGG + Intergenic
985297816 4:188454623-188454645 CAGAGGGACAAATGAGAACATGG - Intergenic
986252376 5:6072153-6072175 CATTGGGAATAAAGAACACATGG + Intergenic
986599733 5:9459958-9459980 CAGTGGTTCTAAAGAAAGCAAGG + Intronic
987323439 5:16791290-16791312 CTGTGGGAATTAAGAGAAAATGG - Intronic
987663846 5:20909751-20909773 CAGTGCAACTAAAGACTACAAGG - Intergenic
988385892 5:30564965-30564987 CTGGAGGACTAAAGACAACATGG - Intergenic
988445189 5:31278354-31278376 CAAGGGAACTAAAGACAACATGG + Intronic
988758839 5:34292439-34292461 CAGTGCAACTAAAGACTACAAGG + Intergenic
988974878 5:36505158-36505180 CAGTGGGGGTAAAGGGAACATGG + Intergenic
989550189 5:42726154-42726176 CTGGGTGAATAAAGAGAACAAGG - Intergenic
990640449 5:57778129-57778151 CAATGGTACAAAAGAGAAAATGG + Intergenic
991089618 5:62681477-62681499 CAGAAAGAGTAAAGAGAACATGG + Intergenic
994397798 5:99240500-99240522 TAGTGAGAATAAAGAGAACATGG + Intergenic
995407126 5:111810985-111811007 CACTGGGAATAAAAAAAACAAGG + Intronic
995823851 5:116270579-116270601 CATGGGGACTAGAAAGAACAGGG + Intronic
996870121 5:128181139-128181161 CATGAAGACTAAAGAGAACAAGG - Intronic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000141504 5:158408708-158408730 AAGTGGGAAAAAAGAGAAAAAGG - Intergenic
1000748235 5:165062143-165062165 CAGTGGATCTAGAGCGAACAGGG - Intergenic
1000942829 5:167383430-167383452 CTGTGGGACTTGAGAAAACATGG - Intronic
1000948213 5:167448217-167448239 CAGTGCGACCAAAGACACCATGG + Intronic
1001893470 5:175359121-175359143 CAGTGAGCCCAAAGAGGACAGGG + Intergenic
1003207078 6:4022025-4022047 CTGCTGGACTAAAGAGTACAAGG - Intronic
1006026642 6:31151175-31151197 AAGTGGGAGTGAAGGGAACAAGG - Intronic
1006682626 6:35808068-35808090 CAGAGAGACTACAGAGAACAGGG - Intronic
1006922608 6:37636570-37636592 CAGTGGGACTCCTGAGAACACGG - Exonic
1007197825 6:40077908-40077930 GACTAGCACTAAAGAGAACATGG - Intergenic
1007488249 6:42197444-42197466 CTTTGGAACTAAAGAGATCAAGG - Intergenic
1007803420 6:44417669-44417691 TGAAGGGACTAAAGAGAACATGG + Intronic
1008007616 6:46428340-46428362 CAGTGGGAATAAATACTACAAGG - Intronic
1008181348 6:48333670-48333692 TAGTGAGAATATAGAGAACAGGG - Intergenic
1009975202 6:70664632-70664654 CAGTGGCAGTATGGAGAACATGG - Intergenic
1010355579 6:74928665-74928687 CTGTGGGATGACAGAGAACAGGG + Intergenic
1010795244 6:80110737-80110759 CAGTGGGTCTTAAGAGCCCAGGG + Intronic
1010976976 6:82326145-82326167 CTGTGAGAACAAAGAGAACAGGG - Intergenic
1011546963 6:88491946-88491968 GTGTGGGACTTAAGTGAACAGGG - Intergenic
1011591641 6:88975696-88975718 TAGAGGCATTAAAGAGAACATGG - Intergenic
1011616424 6:89202018-89202040 CAGTGGGCCAACAGAGATCAGGG - Intronic
1012275779 6:97273841-97273863 TAGGGGGACAAAAGAGAGCATGG - Intronic
1012662579 6:101921035-101921057 CAATGGGAATAAACAGAAAATGG + Intronic
1014435632 6:121418052-121418074 CAGTGGGTTTAAAAATAACAAGG + Intergenic
1014529329 6:122540734-122540756 CAGTGAGACAAAAGTAAACAAGG - Intronic
1015807019 6:137119947-137119969 CAGGAGGACTAGAGAGACCACGG - Intergenic
1015825289 6:137304628-137304650 CAGTGAGACTTAGCAGAACAAGG + Intergenic
1017380860 6:153827592-153827614 CAGTGAGGCAAGAGAGAACAAGG - Intergenic
1017841983 6:158229875-158229897 CTGTCAGACTAAAGAGAAGAAGG - Intergenic
1017854812 6:158341062-158341084 AGGAGGGAATAAAGAGAACATGG - Intronic
1018130717 6:160730250-160730272 CAGTGGGACTCAAGATATAAAGG - Intronic
1020025887 7:4899752-4899774 CTGTGGGAGTAAACAGAAGACGG + Intergenic
1021692021 7:23239956-23239978 CTGAGGGACCAAGGAGAACAAGG - Intronic
1022623288 7:32007215-32007237 CAGTGGTACTGAACAGAAAATGG - Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024693098 7:51824295-51824317 CAGTGGGAGCAAAGAGAATATGG - Intergenic
1025251255 7:57352958-57352980 CAAGGGGACTAAAGAGACCTAGG + Intergenic
1027747965 7:82102122-82102144 AATCGGGACTAAAGAGAAAAAGG + Intronic
1028167280 7:87552149-87552171 CAAAAGGCCTAAAGAGAACACGG - Intronic
1028659177 7:93248818-93248840 CAGTGGGACTAAAAAGAACACGG + Intronic
1028800236 7:94955472-94955494 CAGTGGGAATAAAAAGAAATAGG - Intronic
1029994755 7:104996691-104996713 CAGTGGGAGTGAAGACAACGAGG + Intergenic
1030717080 7:112821463-112821485 CAATAGCACTAAAGAGAAAAAGG + Exonic
1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG + Intergenic
1032598450 7:133267050-133267072 AAGTGGGACTAAAGAGATGCAGG - Intronic
1032818450 7:135501440-135501462 ATGAGGGACTAAAGAGAAGATGG + Intronic
1034783073 7:153899391-153899413 CATTGGCACTAAAGAGAGCTGGG + Intronic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037436252 8:18866562-18866584 CAGTGAGAATAAAAAGAACAAGG - Intronic
1037952482 8:23028137-23028159 GAGAGGGACTGAAGAGACCAGGG + Intronic
1039243758 8:35585206-35585228 CAGAGGGATTACAGAGCACAAGG + Intronic
1039545410 8:38406984-38407006 CACTGAATCTAAAGAGAACATGG + Exonic
1041203554 8:55475095-55475117 CAGTGATACTAAATAGTACACGG + Intronic
1042184033 8:66119484-66119506 CAAAGAGACAAAAGAGAACATGG + Intergenic
1043762506 8:84085415-84085437 CAATGGATCTACAGAGAACATGG - Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1048033877 8:130658454-130658476 CTGTGAGACTCATGAGAACAGGG - Intergenic
1052419944 9:28231125-28231147 CAGTGGGATCAATGAGATCAAGG + Intronic
1053190360 9:36060953-36060975 CAATGGAACTAGAAAGAACAAGG - Intronic
1055069818 9:72154767-72154789 CAGCGACAGTAAAGAGAACATGG - Intronic
1057062173 9:92015111-92015133 CAGTAGAATTAAAGAGAACATGG + Intergenic
1057326087 9:94065452-94065474 CAGTAGGACTAAAGTGAAGGTGG - Intronic
1058638034 9:107055971-107055993 CAGTGGGAGTAAAGGGCACCTGG + Intergenic
1059931378 9:119264272-119264294 TAGTGGGATTAAATAAAACAAGG + Intronic
1059963452 9:119589965-119589987 CACTGGGAAGAAATAGAACAAGG - Intergenic
1060211140 9:121711131-121711153 CAGAGGTACGAAAGACAACAAGG - Intronic
1060724828 9:125999806-125999828 CACTGGGAGGAAAGAGAGCAGGG - Intergenic
1061880405 9:133566094-133566116 CAGTGGGATTACAGAGTACGGGG + Intronic
1187963612 X:24589183-24589205 CAGTGAGAATAAAAAGAAAAAGG - Intronic
1188793032 X:34427083-34427105 CAGTGGGATTAAAGAAACAATGG + Intergenic
1188893780 X:35642367-35642389 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
1190176473 X:48154821-48154843 CAGTGGCAATAAACAGAACCAGG + Intergenic
1191936741 X:66435131-66435153 CAGAGAGACCAAAGAGAGCAAGG + Intergenic
1195356547 X:104044798-104044820 CAGTGAAACTTAAGAGGACAAGG - Intergenic
1196910487 X:120479951-120479973 CAGTGAGATGAAAGTGAACAGGG + Intergenic
1197609963 X:128627051-128627073 AAGTGGAACTAAAGAGAAGTAGG + Intergenic
1197627305 X:128816530-128816552 CAGTGGGAATAAAAAGGACAAGG + Intergenic
1201012290 Y:9559471-9559493 CAGATTGACAAAAGAGAACAAGG - Intergenic