ID: 1068033841

View in Genome Browser
Species Human (GRCh38)
Location 10:51735824-51735846
Sequence GCCCCCTGCCCCATATCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068033841 Original CRISPR GCCCCCTGCCCCATATCCAT GGG (reversed) Intronic
900824668 1:4916817-4916839 GCCAGCTGCCCCATTTCCAGTGG + Intergenic
902361175 1:15943371-15943393 GCCCCCTCCCCCACACCCACTGG - Intronic
902796806 1:18805543-18805565 ACCCCCAACCCCATATCCAGAGG + Intergenic
903321642 1:22546893-22546915 ACCCCAGGCCCCACATCCATGGG + Intergenic
903741399 1:25560594-25560616 GCTCCCTCCCCCATGACCATTGG + Intronic
905546963 1:38807627-38807649 GCACCCTCCCCCACATCGATGGG - Intergenic
908394514 1:63713230-63713252 GCCCCTTGCCCTTTATTCATTGG - Intergenic
912172642 1:107119053-107119075 GCCCCCTGCCCCTTATCCATGGG - Intergenic
912554499 1:110506466-110506488 GCCCCCTGCCCCCTCTCCAAAGG + Intergenic
912710290 1:111944966-111944988 GGCCCCTGCCCCATCATCATGGG - Intronic
913260007 1:116989271-116989293 CCCACCTGCCCCATGTCCACTGG + Exonic
914681321 1:149940466-149940488 GCTCTCTGCCCCATCTCCAATGG - Exonic
916834315 1:168526934-168526956 CCCCCTTGTCCCATATTCATTGG - Intergenic
919755880 1:201066114-201066136 GACCCCTGTCCCATCTCCCTGGG - Intronic
920540476 1:206774199-206774221 GTCCCCTGACCCTGATCCATAGG - Intergenic
920682125 1:208081356-208081378 GCCCCCTACCCCATCTCCATTGG + Intronic
923030486 1:230245772-230245794 GCTACCTGTCCCATAACCATGGG + Intronic
1066758084 10:38730387-38730409 GGCGACTGCCCCATATCCACGGG - Intergenic
1067345350 10:45434162-45434184 GGCCCCTGCCCCGTCTCAATTGG + Intronic
1067527343 10:47046626-47046648 CCCCAGTGCCCCTTATCCATTGG - Intergenic
1068033841 10:51735824-51735846 GCCCCCTGCCCCATATCCATGGG - Intronic
1072270719 10:93773836-93773858 GCCCTCTGCCCCAGTTCCATGGG - Intronic
1073150582 10:101308763-101308785 GCCCCATCCCCCATCTCCCTGGG + Intergenic
1074325193 10:112444294-112444316 GCCCTCTTCCCCATCTCCTTTGG + Intronic
1074814841 10:117135997-117136019 ACCCCCTGCCCCAGCACCATGGG - Intronic
1074846944 10:117406819-117406841 GCCCTCTGCCCCAGAGCCATCGG - Intergenic
1075015462 10:118907413-118907435 TCCACCTTCCCCAGATCCATTGG + Intergenic
1075117486 10:119639009-119639031 GCCCCCTGGCACATAGACATGGG - Intergenic
1075561610 10:123472606-123472628 GCCCCCTGCCCCTGAGCCAGAGG - Intergenic
1076636612 10:131885345-131885367 GCGCCCTGCCCCAAGTCCCTGGG + Intergenic
1077192790 11:1262422-1262444 GCCCCCTGCCCCCTGTCCCCTGG - Intergenic
1077451875 11:2653321-2653343 GCCCCCAGGCCCATGTCCGTAGG + Intronic
1078395771 11:10980643-10980665 GCCCCCTGTCCCATTTCTTTTGG + Intergenic
1079173235 11:18115956-18115978 GCCTCCTGCCCCCTATCCTGTGG + Intronic
1079626777 11:22625673-22625695 GCTACCTGCGCCACATCCATCGG - Exonic
1081752091 11:45518562-45518584 GCCCTCTCCCCCATCTCCGTAGG + Intergenic
1083481939 11:62954648-62954670 GCCCCCTGCCCTACAGTCATTGG + Intronic
1083805207 11:65069381-65069403 GCCCCCTGCCACAAGTCCATGGG - Intronic
1084033091 11:66492476-66492498 GCCGCCTGCCCCTTCTCCCTGGG - Intronic
1084774169 11:71364607-71364629 CCCCCCTGCCCCATAACAATGGG + Intergenic
1088904313 11:114142836-114142858 GCCTCCTCCCCCATCCCCATCGG + Intronic
1089653716 11:119932191-119932213 GCCCCTTGCCTCATATCCCTGGG - Intergenic
1089733134 11:120532021-120532043 TCCACCTGCCCCACATCCAGAGG - Intronic
1090193213 11:124791593-124791615 GCCCGCTGCCCAATATCAGTGGG + Intronic
1092051070 12:5470586-5470608 GCCCCCTGCCCTGCAGCCATGGG - Intronic
1093143843 12:15541064-15541086 TCCCCCTTACCCATATACATAGG + Intronic
1094839719 12:34337860-34337882 GCCCCCTGCCGCATATCTTTGGG + Intergenic
1094842626 12:34348428-34348450 CCCCCCTGCCGCATATCCTTGGG - Intergenic
1096216260 12:49799119-49799141 GCCCCCTGCCCCACAACCTATGG + Intronic
1096498924 12:52053975-52053997 GCCCCCTGCCCCTCCCCCATGGG - Intronic
1096738113 12:53672117-53672139 CTCTCCTGCCCCATATCCCTTGG - Intronic
1097182342 12:57178597-57178619 GCCCCGAGCCCCTTACCCATGGG - Exonic
1097594512 12:61611806-61611828 AGCCCCAGCCCCTTATCCATGGG + Intergenic
1101584442 12:106072688-106072710 CTCCCCTGCCCCATACACATTGG + Intronic
1101875068 12:108592181-108592203 GCCCTCAGCCCCACATCGATGGG - Exonic
1104846799 12:131851045-131851067 GCCCGCAGCCACAGATCCATCGG - Exonic
1106134000 13:26961008-26961030 GCCCCCAGCCCCTTGCCCATGGG + Intergenic
1106707832 13:32300589-32300611 GCTTCCTGCCCCTTATTCATCGG + Intergenic
1108786691 13:53911578-53911600 TCCCCCCTCCCAATATCCATGGG + Intergenic
1112159069 13:96849513-96849535 GCCCCCTGCCCACTATGCAGAGG - Intergenic
1113097290 13:106679525-106679547 GCCCCCAGCCACATTTCCCTAGG + Intergenic
1114672242 14:24417464-24417486 GCCCCCTGCCCCAGGGCCGTGGG + Exonic
1118046802 14:61978832-61978854 CCCCACTGCCCCATATATATTGG + Intergenic
1119415611 14:74467438-74467460 GCCCCCTGCCCCCTCTCCTGGGG - Intergenic
1122130385 14:99601881-99601903 TGCCCCTGCCCCACCTCCATGGG + Intronic
1123441486 15:20295120-20295142 GGCCACTGCTCCATATCCACGGG - Intergenic
1124255208 15:28135663-28135685 GCCACCTGCACCATACCCAGTGG + Exonic
1124569103 15:30843953-30843975 GCCACCTGCACCATACCCAGTGG - Intergenic
1126122746 15:45268188-45268210 GCCCTCTGCCCAATAACCACAGG + Exonic
1127177885 15:56381574-56381596 GCCCCCTGCCCAATATCACTAGG + Intronic
1128147065 15:65337642-65337664 GCCCCCTCCCCCAAGTCCCTGGG - Intronic
1128980420 15:72181346-72181368 CTCCCCTGCCCCACTTCCATGGG - Intronic
1132030805 15:98437391-98437413 CCCCCCTGCCCCTTATACTTGGG - Exonic
1133956312 16:10446931-10446953 GCCCCCTGCCCCCCAACCACTGG + Intronic
1135081419 16:19439429-19439451 GTCCCCTCCCCCATAACCAAGGG + Intronic
1135425007 16:22328093-22328115 GCCCCCTTCCCCATAACTCTTGG - Intronic
1136687677 16:32004646-32004668 GCCCCCTTGCCCTTAGCCATCGG + Intergenic
1136788285 16:32948196-32948218 GCCCCCTTGCCCTTAGCCATCGG + Intergenic
1138489171 16:57366220-57366242 GCCCCCTGCCCCATCTCACAGGG - Intergenic
1139348408 16:66320019-66320041 GCCCTCTGCGCCATGTCCTTGGG - Intergenic
1142011065 16:87714405-87714427 ACCGCCAGCCCCACATCCATGGG + Intronic
1142251132 16:88992572-88992594 GCCCCCTGCCCAGTATCTCTCGG - Intergenic
1143335467 17:6168825-6168847 GCCCCTTGCTCCCTTTCCATGGG - Intergenic
1143584723 17:7845393-7845415 GCCCCCTGCCCCAGCTCTCTGGG - Exonic
1143978522 17:10847767-10847789 GCCCCCACCCCCAAATTCATAGG + Intergenic
1144020339 17:11235438-11235460 GCTTCCTTCCCCATTTCCATTGG - Intergenic
1144737747 17:17564373-17564395 GCCCTCTTCCCCATCTCCCTTGG + Intronic
1144872361 17:18379116-18379138 GCCCCCTGCACCACACCCACTGG - Intronic
1144873569 17:18384768-18384790 GCCCCCTGCACCACACCCACTGG - Intronic
1146906789 17:36623033-36623055 ACCCCGTGCCCCATATCAGTAGG - Intergenic
1147148663 17:38500315-38500337 GCCCCCTTGCCCTTAGCCATCGG + Intronic
1147689917 17:42308738-42308760 TCCAGCTGCCCCAAATCCATTGG + Intronic
1151148687 17:72065094-72065116 CCCCCCACCCCAATATCCATGGG + Intergenic
1151748902 17:76025906-76025928 GCCCCCTGCACCACACCCACTGG + Intronic
1152569403 17:81115137-81115159 GCGCCCTCCCCCATATCCCCGGG - Intronic
1161086724 19:2338871-2338893 GCCCCCTGCCCCATCTCCTCGGG - Intronic
1161494096 19:4578233-4578255 GCCACCGGCCCCATGTCCTTTGG - Intergenic
1161811173 19:6472178-6472200 GCCCCCCCACCCATATCCCTAGG + Intronic
1162110274 19:8396265-8396287 GCCGCCTGCCCCATACCTAGAGG - Intronic
1166485130 19:43205955-43205977 GCACCCTACCCCAGAGCCATGGG - Intronic
1166801990 19:45463496-45463518 CCCTCCTGACCCATATCCGTGGG - Intronic
925611036 2:5703402-5703424 GCCCTCTGCCCCAGCTCCATGGG + Intergenic
927280334 2:21299201-21299223 GCCCCCTGCCCCAAGTACTTTGG + Intergenic
927844576 2:26464826-26464848 GCCGCCTGCCCCCTCTCCAGGGG - Intronic
928166513 2:28976491-28976513 GCTCCCTGCCCCACAGCCACAGG - Intronic
929937704 2:46306291-46306313 GCTCCCTGCCCCCTAACCAGAGG - Intronic
932087531 2:68775169-68775191 GCTCACTGCCCCATGTCCCTCGG + Intronic
936154583 2:110039828-110039850 TCCCCCTGCCCCATCCCCAGTGG - Intergenic
936190100 2:110331586-110331608 TCCCCCTGCCCCATCCCCAGTGG + Intergenic
936345774 2:111673785-111673807 GACCCCTGCCCCATGTGCAAGGG + Intergenic
937448761 2:121982533-121982555 GCTCCCAGCCCTATAGCCATAGG + Intergenic
938190883 2:129279554-129279576 GTCCCATGCCCCATATCCTCAGG + Intergenic
942770132 2:179507289-179507311 GCCCCCTGCAGCCTATTCATGGG + Intronic
946163523 2:217849998-217850020 GCCCACTGCCACATTTCCAGAGG + Intronic
946381103 2:219349608-219349630 GTGCCCTGCCTCATATCCAATGG - Intergenic
946908823 2:224441495-224441517 GCCCCCTGACCCATCTCCTTTGG - Intergenic
947520092 2:230838885-230838907 GTCCCCTGCCCCACCTCCACTGG + Intergenic
947995520 2:234524049-234524071 GTCACATGCCCCATATACATGGG + Intergenic
1169648685 20:7842826-7842848 GGGTCCTGCCCCATATCCAGGGG + Intergenic
1169748827 20:8970673-8970695 CCCCCCTCCCCCATAGCCACAGG + Intergenic
1170566725 20:17611914-17611936 GCCCCCTGTACCAGATGCATGGG + Intergenic
1171012158 20:21514644-21514666 GCCCCCTCCCCCTTTTCCAAAGG - Intergenic
1174338953 20:49884081-49884103 GCCCCCTGCCCCACCCCCACAGG - Intronic
1175985679 20:62763161-62763183 GCCCCCTCCCCCACAACCACAGG - Intergenic
1178914266 21:36698256-36698278 GCCTTCTGCCCCATCACCATGGG + Intergenic
1179524222 21:41965359-41965381 GCCCCCTGCCCACTATCCAGTGG - Intergenic
1179912957 21:44459970-44459992 GCCCCCTGCCCCACCAACATAGG + Exonic
1180914555 22:19476574-19476596 CCCCCCACCCCCATATCCACAGG + Intronic
1181139032 22:20790249-20790271 GCTTCCTGCCCCAAATCCACTGG + Intronic
1184254151 22:43277514-43277536 GCCCCTGGCCCCCCATCCATTGG + Intronic
1184593313 22:45500048-45500070 GCCACCTGCTCCATCCCCATTGG + Intergenic
1184686829 22:46100016-46100038 GCCCCCTGCCCATGATCCAGGGG - Intronic
1184919062 22:47592915-47592937 GCCTGATGCCCCATCTCCATGGG - Intergenic
949881475 3:8664302-8664324 GCCATCTGCCACAGATCCATGGG + Intronic
952333726 3:32387213-32387235 CCTCCCTGCCCCAAATACATAGG + Intergenic
953407376 3:42666086-42666108 GCTCCCTGCCCCAGTGCCATGGG - Intergenic
954426572 3:50446556-50446578 GCCCCCTTGGCCATGTCCATTGG + Intronic
954713577 3:52516463-52516485 GCCACCTGCCCCCTCCCCATTGG - Intronic
956886015 3:73560644-73560666 GCCCCTTTTCCCATATTCATGGG + Intronic
960006923 3:112790387-112790409 GCTGCCTGCCCCATAACAATAGG - Intronic
960511573 3:118555493-118555515 GCCCTGTACCCCATATCCCTTGG + Intergenic
961666096 3:128493845-128493867 TCCCCCTGGCCCATCTCCTTGGG + Intergenic
961912119 3:130328656-130328678 GCCCCCTGGCCACTATTCATTGG - Intergenic
966230038 3:177641719-177641741 AGCCCCTGCCCCATTGCCATTGG - Intergenic
968703282 4:2066727-2066749 GCCCCCTGCCCGCTCCCCATGGG + Exonic
982050883 4:151500491-151500513 GACCCCTGCCCCATGTCACTTGG + Intronic
982432661 4:155340128-155340150 GCCCACAGGCCCCTATCCATGGG + Intergenic
986082102 5:4405619-4405641 CCCCCCTGCCCCAAATCTAAAGG - Intergenic
986775013 5:11006361-11006383 GCCCACTGCCTCACCTCCATTGG - Intronic
988682237 5:33495327-33495349 GCCCTCTGCTCCATAGCTATTGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
996873252 5:128215425-128215447 GCCCCCTGCCTCCTACCCCTTGG + Intergenic
997869766 5:137497578-137497600 GCCTCTTGCCCCACATCCCTGGG + Intronic
998403778 5:141862386-141862408 TCCCCTTGCCCCATGTCTATAGG - Intronic
999487475 5:152012976-152012998 TCCCCCTTCCCCACATCCCTAGG + Intergenic
1000056223 5:157608911-157608933 GCCCCCTTCCCCTTCTCCTTCGG + Intergenic
1000463205 5:161547303-161547325 ACCCCCCGCCCCAAATCCAACGG - Intronic
1000878367 5:166668333-166668355 GCCCCCATCCCCATAGCTATGGG + Intergenic
1005334217 6:24776595-24776617 GCCCACTGCCCACTACCCATTGG - Intronic
1006291414 6:33140242-33140264 TCCCCCTACCCCATTCCCATAGG + Intergenic
1008329827 6:50231623-50231645 GCTCCCTGCCCTATATGAATTGG - Intergenic
1013089707 6:106888941-106888963 GGGTCCTGCCCCATATCCAGGGG + Intergenic
1018610335 6:165642182-165642204 TCCCACAGCCCCACATCCATAGG + Intronic
1018926365 6:168209579-168209601 GACCCCTGCCCCGTCTCCACTGG - Intergenic
1027604805 7:80287585-80287607 CCCCCCTGCCCCAAGTCCACTGG - Intergenic
1029207873 7:98879606-98879628 ACCCCCTTCCCCATCTCCATCGG - Intronic
1034440624 7:151083891-151083913 GCCCAGAGCCCAATATCCATGGG + Intergenic
1041060591 8:54031058-54031080 GCCTCCTACTCCACATCCATTGG + Intergenic
1041193343 8:55375327-55375349 GCGCTCTTCCCCTTATCCATTGG - Intronic
1041481950 8:58331899-58331921 GGCTCCAGCCCCATTTCCATGGG - Intergenic
1041958811 8:63587560-63587582 CCCCCCCGCCCCATAACCTTTGG + Intergenic
1042103261 8:65297118-65297140 GCCCCCCGCCCCACAACCACTGG - Intergenic
1043924140 8:86017637-86017659 GCCACCTGCCTCATGTCCAAGGG - Intronic
1044618514 8:94166487-94166509 TCCCCCTCCCCCAGATTCATAGG - Intronic
1044802866 8:95975064-95975086 GCCCCCTCCTCCATCTCCAAAGG - Intergenic
1045379100 8:101605204-101605226 GCTCCCTTCCCCACCTCCATTGG - Intronic
1050420509 9:5459404-5459426 GCCAGCTGCCTCATTTCCATTGG - Intronic
1052369151 9:27645088-27645110 GTCCCCAACCCCCTATCCATAGG + Intergenic
1053430953 9:38041407-38041429 CCCTCTTGCCCCATACCCATAGG - Intronic
1057807674 9:98231974-98231996 CCCCACTGCCCCATAACCCTAGG - Intronic
1059426347 9:114223200-114223222 GCCCCCTCCGCCCTGTCCATTGG + Intronic
1060916575 9:127395532-127395554 GCCTCCTGCCCCCTTTTCATAGG - Intergenic
1061844313 9:133378364-133378386 GCCCCCTGCCCCATAGCACTTGG + Intronic
1203776015 EBV:73555-73577 GCCCCCGGCCCCATACACGTGGG - Intergenic
1186180486 X:6968433-6968455 CCCCCCTGCCCCAGACCCACAGG - Intergenic
1186299258 X:8181443-8181465 GCCCCAAGCCCCATTCCCATTGG - Intergenic
1187943406 X:24403122-24403144 TCCCCCTGCCCCCTCCCCATAGG + Intergenic
1188042888 X:25390649-25390671 GCCTCTTGCCCAGTATCCATAGG + Intergenic
1188267774 X:28098689-28098711 GCCCCCAGTCCCATGTCCTTTGG + Intergenic
1188802577 X:34550033-34550055 GCCAGCTGCTCCATAGCCATGGG - Intergenic
1192805669 X:74506398-74506420 GCTCCCTGCCCCATATCACTAGG - Intronic
1197530430 X:127617043-127617065 GCCCAATGCCCCATGTCCATGGG + Intergenic
1200011692 X:153125128-153125150 GGCCACTGCCCCATCTCCAGGGG - Intergenic
1200027909 X:153274791-153274813 GGCCACTGCCCCATCTCCAGGGG + Intergenic
1201675947 Y:16584273-16584295 ACCCCCTGCTCCATTTCCAAAGG + Intergenic