ID: 1068037227

View in Genome Browser
Species Human (GRCh38)
Location 10:51776034-51776056
Sequence GTGGGGAAACCGACTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068037227_1068037231 17 Left 1068037227 10:51776034-51776056 CCTTTCTCAGTCGGTTTCCCCAC 0: 1
1: 0
2: 1
3: 21
4: 150
Right 1068037231 10:51776074-51776096 ATTAAGAGTACCTATTTCAGTGG No data
1068037227_1068037232 18 Left 1068037227 10:51776034-51776056 CCTTTCTCAGTCGGTTTCCCCAC 0: 1
1: 0
2: 1
3: 21
4: 150
Right 1068037232 10:51776075-51776097 TTAAGAGTACCTATTTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068037227 Original CRISPR GTGGGGAAACCGACTGAGAA AGG (reversed) Intronic
904371936 1:30053464-30053486 GTGGGGAGACCGCCTGAGGATGG + Intergenic
907747369 1:57226711-57226733 GTGAGGAAACAGGCTGAGAAAGG + Intronic
908938493 1:69404143-69404165 GTAAGGAAACAGACTAAGAAAGG + Intergenic
909473368 1:76054621-76054643 GTGGGGAAATTGACTGGGGAAGG + Intergenic
913540931 1:119820347-119820369 GTGGGAAGACTGACTGGGAAAGG - Intergenic
914227125 1:145729789-145729811 GTGTGGAAATGGAGTGAGAATGG - Intronic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
916277045 1:163006267-163006289 GTGGGGAAACTGACTGGCAGTGG + Intergenic
917194702 1:172452936-172452958 GTAAGGAAACCGAGTGAGAAGGG + Intronic
919819140 1:201462013-201462035 GTGGGGAGACCGAGGGAGAAGGG - Intergenic
921678672 1:218006257-218006279 GTGGGCAAAGGGAGTGAGAAAGG - Intergenic
922490396 1:226011969-226011991 GTGTGGAAACAGACTCAGAAAGG + Intergenic
1063196677 10:3749838-3749860 GTCGGGGAACTGGCTGAGAAGGG + Intergenic
1063741413 10:8825595-8825617 GTGTAGAAAAAGACTGAGAAGGG + Intergenic
1064123128 10:12636647-12636669 ATGAGGAAACAGACTGAGAGGGG + Intronic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1070523437 10:77274885-77274907 GTGGGGAGAGAAACTGAGAAGGG + Intronic
1071420415 10:85491747-85491769 GTGGATAAACCGTCTGATAAGGG + Intergenic
1072816558 10:98515125-98515147 GTGGTCAAGCCGACTGAGAGTGG + Intronic
1073477893 10:103766278-103766300 GGGGGGAAGCCCACTGTGAAGGG + Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1077181361 11:1218661-1218683 GTGGGGAGACAGGCAGAGAAGGG + Intergenic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078488745 11:11749516-11749538 GTGGGGATAATGACTGAGAGGGG + Intergenic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1080241580 11:30133315-30133337 GTGGAGAAAGCGTCTGGGAAGGG - Intergenic
1080930454 11:36804815-36804837 CTGGGGAAAGAGTCTGAGAAAGG + Intergenic
1082086479 11:48054504-48054526 GTGAGGAAACAGACTTGGAAAGG + Intronic
1085392286 11:76188675-76188697 ATGGGGAAACAGACACAGAAGGG + Intronic
1085557719 11:77440503-77440525 ATGAGGAAACAAACTGAGAAAGG + Intronic
1088113056 11:106284117-106284139 GTTGGGAGACCTACTGAGATGGG - Intergenic
1091263001 11:134248693-134248715 GTGAGGATGCTGACTGAGAAAGG + Intronic
1091573896 12:1714662-1714684 GTGGGGATCCACACTGAGAATGG + Intronic
1092058036 12:5523246-5523268 GTGGGGAAACCGGCCCAGAGAGG + Intergenic
1095262116 12:40108754-40108776 GTGGGAAAGACGATTGAGAAGGG - Intergenic
1095537896 12:43273628-43273650 GTGAGGAAAGAGACTCAGAAAGG - Intergenic
1096097334 12:48944719-48944741 GTGTGGAAAATGGCTGAGAATGG - Intronic
1103732975 12:123041025-123041047 GTGTGTAAACAGACAGAGAAGGG + Intronic
1105281141 13:18963189-18963211 GTGAGGAAGCCGACGGAGAGAGG + Intergenic
1105641407 13:22268845-22268867 GTGGGGAGCCAGACTGAGCAGGG + Intergenic
1106324781 13:28677872-28677894 GTGGGGTGACTGACTGAAAAGGG - Intronic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1119176856 14:72574831-72574853 GTGGGCACAGAGACTGAGAAAGG + Intergenic
1121683664 14:95815582-95815604 GTGAGGAAACCGACTCAGGGAGG - Intergenic
1122884031 14:104702645-104702667 CTGGGGAGACGGGCTGAGAATGG - Intronic
1123185580 14:106513500-106513522 GTAGGGAAACTGAAAGAGAATGG - Intergenic
1123757490 15:23408246-23408268 GTGGGGGAACTGAATTAGAAGGG - Intergenic
1124444475 15:29717659-29717681 GTGAGGAAACAGACTCAGATTGG - Intronic
1129209187 15:74056607-74056629 GAGGGGACAGCAACTGAGAAGGG - Intergenic
1129244263 15:74270185-74270207 GTGGGAAAACCAGCTGAGATGGG + Intronic
1129404411 15:75305669-75305691 GAGGGGACAGCAACTGAGAAAGG + Intergenic
1129478049 15:75800454-75800476 GAGGGGACAGCAACTGAGAAGGG + Intergenic
1130699454 15:86164104-86164126 CTGGGGGAACCGACAGAGATTGG + Intronic
1131022332 15:89109390-89109412 GTGGGCTAGCCGACAGAGAAGGG + Intronic
1133547512 16:6822106-6822128 TGGGGGAGACAGACTGAGAAAGG + Intronic
1134458842 16:14414514-14414536 GTGGGGGAACTGAATTAGAAGGG + Intergenic
1138074177 16:54024656-54024678 ATGGGAAAACCGAGGGAGAATGG - Intronic
1138344141 16:56309510-56309532 GTGGGGACAAGGACAGAGAAGGG + Intronic
1140073898 16:71678544-71678566 GTGGGAGAATCGCCTGAGAACGG + Intronic
1140528762 16:75646612-75646634 TTGGGGAAAGCGATGGAGAAGGG + Intronic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1146286306 17:31576349-31576371 GTAGGGAGACCTGCTGAGAATGG - Intergenic
1157598558 18:48878632-48878654 GTGGGGAACAATACTGAGAAAGG + Intergenic
1157662975 18:49461513-49461535 GTGAGGAAACTGGCTGAGAGAGG - Intergenic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1160578912 18:79872741-79872763 GTGAGGAAACAGGCTCAGAATGG - Intronic
1162017767 19:7854804-7854826 GTGGGGAAACTGAGTCAGAGTGG - Intronic
1162119883 19:8457599-8457621 GTGGGTAAAGTGACTCAGAAAGG + Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1166973951 19:46592470-46592492 GTAGGGAAGCCGACTGAGCATGG + Intronic
1168530480 19:57124371-57124393 GTGGGGAGAGAGACAGAGAAAGG - Intronic
926111192 2:10184820-10184842 ATGGGGAAACTGAGTCAGAAAGG + Intronic
926758225 2:16252919-16252941 GTGGGGAAACAGGCTGAGAGAGG + Intergenic
927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG + Exonic
930352057 2:50269093-50269115 ATGGGGAAACAGACTTAGACAGG + Intronic
932749583 2:74362907-74362929 GTGGGGGAACCACCTGAGCAGGG + Intronic
933335251 2:80949894-80949916 GTAGGGAAACAGATTGAGAAAGG - Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
943515733 2:188883964-188883986 GTGGGGAAACTGGCTTAGAGAGG - Intergenic
944755501 2:202757332-202757354 TTGGGGACACGGACTGGGAACGG - Exonic
946634813 2:221713049-221713071 GTTGGGACACTGAGTGAGAAGGG - Intergenic
946845905 2:223858911-223858933 ATGGGGAAATCTACTGAGATGGG + Intronic
946965851 2:225037108-225037130 GTGGGGTAAGCAATTGAGAATGG + Intronic
946978396 2:225178439-225178461 GTGAAGAAACGGAATGAGAAGGG - Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1169896219 20:10508018-10508040 ATGGGGAAAGCAACTAAGAATGG - Intronic
1170565019 20:17594869-17594891 GTGGTGATAGCTACTGAGAAAGG + Intronic
1172291864 20:33782670-33782692 GTGGGGAAACCAAGGCAGAAAGG + Intronic
1173173135 20:40743343-40743365 GTGGGGACACAGTCTCAGAAAGG - Intergenic
1175231154 20:57474184-57474206 GTGAGGAAACAGACTCAGAGAGG + Intergenic
1175568512 20:60000236-60000258 GTGTGGAAACAGAATTAGAAAGG + Intronic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1178810826 21:35879413-35879435 ATGGGTAAACCCACTGTGAATGG - Intronic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1180149889 21:45942129-45942151 GAGGGGAAACCGAGTCAGCATGG - Exonic
1180652113 22:17386474-17386496 GTTTGGAAACAGGCTGAGAAAGG - Intronic
1180748920 22:18111136-18111158 CTGGGGAGCCCGACGGAGAAGGG + Intronic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182567089 22:31208226-31208248 GTGGGAGAACCTACTGAGACCGG - Intergenic
950153534 3:10706760-10706782 GTGGGGAAACTGAGTCAGAGAGG + Intronic
952627712 3:35426936-35426958 GAAGGGAAATCGATTGAGAAAGG + Intergenic
954404565 3:50338125-50338147 GTGAGGTAACCCACTGAGATAGG - Intronic
955024833 3:55157336-55157358 ATGGGGAACCCAACTGTGAACGG - Intergenic
955741199 3:62093423-62093445 GTGGGGAAACCAACAGACAATGG - Intronic
957799886 3:85063947-85063969 GTGTGGAAACCTACTGGGGAGGG - Intronic
958427337 3:93994190-93994212 GTGATGAAACCAAGTGAGAAAGG - Intronic
958721009 3:97843443-97843465 GTGGGGAAAGGCTCTGAGAAGGG + Intronic
960169786 3:114446245-114446267 GTGGGGTTTCAGACTGAGAATGG + Intronic
960615437 3:119591857-119591879 GTGGGGGAGCTGCCTGAGAAGGG - Intergenic
963466532 3:145688988-145689010 GTGGGGAAACGGAATTAAAAGGG + Intergenic
965420332 3:168449945-168449967 GTGGGGAAACAAAGGGAGAATGG - Intergenic
966051160 3:175618912-175618934 GTGGGAAGACCGAGTCAGAAGGG + Intronic
969552172 4:7877548-7877570 GTGAGGAAACAGACACAGAAAGG + Intronic
969997376 4:11326724-11326746 GTGGAGAAATCGACTGGGCACGG - Intergenic
971073308 4:23119757-23119779 GTGAGGAAACAGACTCAGAGGGG + Intergenic
971161280 4:24136659-24136681 GTGAGGAAACAGGCTGGGAAAGG - Intergenic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
976620808 4:87125738-87125760 GTGTGGGAACCGACAGAGATGGG + Intronic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985612162 5:896021-896043 GTTAGGAAACCGACTGGGCAAGG + Intronic
989641034 5:43583453-43583475 GTGGGGAAACCTACCTAGAAAGG + Intergenic
989780211 5:45255767-45255789 GTGAGGAAAACTCCTGAGAAAGG - Intergenic
993727315 5:91382994-91383016 GTGGGGATACCGTCTCAGGAAGG - Exonic
995215627 5:109591417-109591439 GTGGTGACACCGAATGAGAGGGG + Intergenic
1002928760 6:1619731-1619753 GCGAGGAAGCCGACTGGGAAGGG - Intergenic
1003300414 6:4876102-4876124 GGAGGGAAACTGACTGGGAAGGG - Intronic
1003408991 6:5846799-5846821 CTGGGGAAACAGCCTGAGACAGG + Intergenic
1005155619 6:22802784-22802806 GGGTGGAAATAGACTGAGAAAGG + Intergenic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1007694729 6:43724998-43725020 GTGGGGAAACAGGCTCAGAGAGG + Intergenic
1011603244 6:89079317-89079339 CTGGGGAAACAGGCTTAGAAAGG - Intergenic
1012945641 6:105463031-105463053 GTGAGGAAATTGACTGAGAAGGG - Intergenic
1013790401 6:113829850-113829872 GTGGGGAAGCAGGCAGAGAATGG + Intergenic
1018157572 6:161001754-161001776 ATGCGGAAACAGACTGAGAGAGG - Intronic
1018646273 6:165951625-165951647 GTTAGGAGACCGAGTGAGAAAGG - Intronic
1019892993 7:3962163-3962185 GTGAGGAAACAGACAAAGAAAGG + Intronic
1021041366 7:15866027-15866049 GTGAGAAAACAGACTGTGAAAGG + Intergenic
1021153619 7:17181935-17181957 GTTGGGAAACTGACTTACAAAGG - Intergenic
1021324843 7:19254181-19254203 GTGAGGAAAATGGCTGAGAAAGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1023119628 7:36896229-36896251 ATAAGGAAACCGACTGAGAAAGG + Intronic
1031337993 7:120561486-120561508 GTGAGGAAACAGATTCAGAAAGG + Intronic
1032854039 7:135819361-135819383 GTGGGGAGACCTAATGAGAATGG - Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1038290415 8:26244273-26244295 GTGAGGAAACAGACTCAGAAAGG - Intergenic
1039351254 8:36766365-36766387 GTGGGGAACCAGAATGAAAAAGG - Intergenic
1039990999 8:42487515-42487537 GTGGGAGAACCGACAGAGAAGGG - Intronic
1040980308 8:53240187-53240209 GTGGGGAAACTGAGTTAAAAGGG + Intronic
1041093915 8:54330399-54330421 CTGAGGAAACCAACTCAGAAAGG + Intergenic
1042433378 8:68734886-68734908 GTGGGGAAACTAATTGTGAATGG + Intronic
1043880152 8:85532982-85533004 GTGTGGAAACAGTCTCAGAACGG + Intergenic
1049414620 8:142489581-142489603 GTGGGGAAACAGGCTCAGAGAGG + Intronic
1051507457 9:17842285-17842307 GTGGGAAAACTGACTCAGAAAGG + Intergenic
1052896310 9:33750866-33750888 GAGGGGATACCGACTGGGAGGGG + Intronic
1055106983 9:72523225-72523247 GTGGGGAAAATGAAGGAGAAGGG + Intronic
1055563700 9:77547219-77547241 GTGGGGAAACACAGTGAAAAAGG + Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1059607370 9:115848575-115848597 GTGGGGAAACAGACTTTGAGAGG - Intergenic
1059709061 9:116850546-116850568 GTGTGGAAGCCAACTCAGAAAGG - Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061201010 9:129138586-129138608 GTCGGGAAAGGGACTGAGGAGGG - Intronic
1186997864 X:15142941-15142963 GGAGGGAAACCAAGTGAGAAAGG - Intergenic
1191845534 X:65544886-65544908 TTGAGGAAACAGACTTAGAAGGG - Intergenic
1192051229 X:67725689-67725711 GTGGGGAATCTGAGTGAGTATGG - Exonic
1196741941 X:119032620-119032642 GTGGGGAGACTGGCTGGGAAGGG + Intergenic
1196748154 X:119090061-119090083 GTGGGGAAACTGACTGGGGAAGG + Intronic
1198055047 X:132985518-132985540 ATGGGGAAACTGACTCAGACTGG - Intergenic
1198573271 X:137981526-137981548 GTGGGGAAACTGACTGAGAGTGG - Intergenic
1201411163 Y:13701025-13701047 GTCAGGAAACCTACAGAGAATGG - Intergenic