ID: 1068037654

View in Genome Browser
Species Human (GRCh38)
Location 10:51781333-51781355
Sequence CACGAAAGCTTTGTAACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068037654_1068037658 23 Left 1068037654 10:51781333-51781355 CCATTGGTTACAAAGCTTTCGTG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1068037658 10:51781379-51781401 CTGTTTCCCCAAAGGCAAGAGGG No data
1068037654_1068037655 0 Left 1068037654 10:51781333-51781355 CCATTGGTTACAAAGCTTTCGTG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1068037655 10:51781356-51781378 TTATGTTGTCATTTTAAGAAAGG No data
1068037654_1068037657 22 Left 1068037654 10:51781333-51781355 CCATTGGTTACAAAGCTTTCGTG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1068037657 10:51781378-51781400 GCTGTTTCCCCAAAGGCAAGAGG No data
1068037654_1068037656 15 Left 1068037654 10:51781333-51781355 CCATTGGTTACAAAGCTTTCGTG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1068037656 10:51781371-51781393 AAGAAAGGCTGTTTCCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068037654 Original CRISPR CACGAAAGCTTTGTAACCAA TGG (reversed) Intronic
900534621 1:3170728-3170750 CAGGACAGCTTTGTTGCCAATGG - Intronic
905925005 1:41743327-41743349 CACGTAAGCTTTGTAAGTAAAGG + Intronic
911186905 1:94913463-94913485 AGCTAAAGCTTTGTAATCAAAGG + Intronic
911304728 1:96219425-96219447 TATGAAAGTTTTGTCACCAATGG + Intergenic
913491599 1:119384932-119384954 TACCAAAGCTTTGAAACCTAGGG - Exonic
916166329 1:161969981-161970003 CAGAAAAGCTTGGGAACCAATGG + Intergenic
916359340 1:163950717-163950739 AACAAAACCTTTGTAATCAAAGG - Intergenic
917474686 1:175359050-175359072 CAAGAAAGGCATGTAACCAAGGG - Intronic
918348827 1:183633194-183633216 CAGGAAAGCATTATAACCACTGG + Intronic
921244736 1:213225821-213225843 CATGGAAGCTGTATAACCAAAGG - Intronic
1068037654 10:51781333-51781355 CACGAAAGCTTTGTAACCAATGG - Intronic
1074461398 10:113641012-113641034 CACAAAAGCTTTGGAACCCTGGG + Intronic
1074805328 10:117044396-117044418 CACGAAAGCCTTATAACTATTGG + Intronic
1076327558 10:129638209-129638231 CAGGAAAGCTGTATAACCACCGG - Intronic
1077732129 11:4742698-4742720 AACAAAAACTTTGGAACCAAAGG + Intronic
1079338209 11:19589776-19589798 CACAGATGCTTGGTAACCAAGGG + Intronic
1079886130 11:25991604-25991626 CAAGAAAGCTTTTAAAGCAACGG - Intergenic
1090337395 11:125981206-125981228 CACGGAGGCTTCCTAACCAATGG - Exonic
1099201498 12:79682853-79682875 CATGTAAGATTTGTAATCAATGG + Intronic
1100390863 12:94145688-94145710 GAGGGAAGCTTTGTCACCAAAGG + Intergenic
1102417141 12:112773769-112773791 CAAGAATGCTTTGTAAAGAAAGG + Intronic
1104790530 12:131479021-131479043 CACGAAACCCTTGTAACCTGTGG + Intergenic
1105320246 13:19313303-19313325 AAAGTAAGCTTTGTAAGCAAGGG - Intergenic
1107165133 13:37274844-37274866 CACCAAAGATTTGGAACCCAAGG + Intergenic
1108362693 13:49682061-49682083 CATTAAAGCCTTGTCACCAAAGG - Intronic
1110194547 13:72772437-72772459 CACGTATGATTTGTAACTAATGG + Intronic
1114157178 14:20118043-20118065 CAGGCAAGCTTAGTAACCAAAGG - Exonic
1123063605 14:105605493-105605515 CACGAAAGCCTTGTGAAGAAAGG + Intergenic
1128271075 15:66310434-66310456 CAAGAAAACTGTGTGACCAAGGG + Intronic
1133929581 16:10221320-10221342 AACAAAAGCTTTTCAACCAATGG - Intergenic
1135207559 16:20495488-20495510 AACCAAAGCTTTGGAACAAAAGG - Intergenic
1135211326 16:20528144-20528166 AACCAAAGCTTTGGAACAAAAGG + Intergenic
1137394424 16:48106725-48106747 CAGGAAAGCTTTGAGACCATTGG + Intronic
1140726543 16:77818434-77818456 CAGGTAAGCAGTGTAACCAAAGG + Intronic
1148642148 17:49195686-49195708 CACTAAAGCTTTGACCCCAAGGG - Intergenic
1158329911 18:56350361-56350383 AACGAAAGTTTTGTAATCAGAGG - Intergenic
1168619323 19:57864811-57864833 CACAAAACCTTTGTAATCAGGGG + Exonic
939247363 2:139643368-139643390 AAAGTAAGCTTTGTAAACAAAGG - Intergenic
944903847 2:204243278-204243300 CATGTCAGCTTTGTCACCAAAGG + Intergenic
947179246 2:227397632-227397654 CATGAAAGGATTGGAACCAATGG + Intergenic
947227483 2:227854080-227854102 CCCCAGAGCTTTGTACCCAAAGG + Intergenic
1173872207 20:46349192-46349214 CTGGAAAGCTTTGTCCCCAAGGG + Intronic
1175122899 20:56730103-56730125 CACGAATGGTCTGGAACCAAGGG + Intergenic
1175584415 20:60126662-60126684 CACAAAAGCCTTGTGACCACTGG - Intergenic
949325897 3:2863987-2864009 CACAAAAGCAGTGAAACCAAAGG + Intronic
951274680 3:20671049-20671071 TAGGAAAGCTTTGTAACCCTGGG + Intergenic
951576192 3:24116694-24116716 CACCATAGCTTTGTAAATAAGGG - Intergenic
953443839 3:42945048-42945070 CACGAAAGCTGTGTAATAATAGG + Intronic
961975736 3:131023071-131023093 CACCAAAGCTTTATCACCATTGG - Intronic
962171823 3:133109212-133109234 CAAGAAAGCTGTGTGACCCAGGG - Intronic
963101675 3:141612586-141612608 TAGAAAAGCTTTGTAACAAAGGG + Exonic
967889624 3:194355942-194355964 ATCAAAAGCTTTGTAACCACAGG - Intronic
969190758 4:5516907-5516929 CAAGAAAGCTTTATAAGCATTGG + Intergenic
970428489 4:15966537-15966559 GAGGAAGGCTTTGTGACCAAAGG + Intronic
971270562 4:25140753-25140775 CATGAAACCTTTCTAACCAATGG + Intronic
974200046 4:58625202-58625224 CATCAAAGCTTTATAAGCAAAGG + Intergenic
977172525 4:93780780-93780802 CACTGAAGATTTTTAACCAAGGG + Intergenic
977223958 4:94372686-94372708 CAGGAAAGCCTGGTAACTAAGGG - Intergenic
978832615 4:113107027-113107049 CACAAAAGCTTTGTTTCGAATGG - Intronic
983596838 4:169478146-169478168 TACGAAAGCTATGAAAGCAAAGG + Intronic
983903614 4:173162732-173162754 CACAAAGGCTTTGTAATAAATGG + Intergenic
988463824 5:31468157-31468179 CAGGAAAGCCTTGTCCCCAAAGG + Intronic
993621316 5:90171299-90171321 CAGGAAAGCTTTATCACCCAAGG - Intergenic
994209949 5:97076224-97076246 CACAAATGCTTTGTCATCAATGG - Intergenic
999712430 5:154330476-154330498 CATGAGAGCTGTGTGACCAAGGG - Intronic
1009289101 6:61862145-61862167 AAGGAAACCTTTGCAACCAAAGG + Intronic
1012053349 6:94372113-94372135 CCTGAAGGCTTTGGAACCAAGGG - Intergenic
1022816984 7:33923350-33923372 CACTAGAGCTTAGTGACCAAAGG - Intronic
1023375174 7:39548746-39548768 CAGGCAAGCTTTAGAACCAAAGG + Intergenic
1024441438 7:49423564-49423586 CATGAAAACTTTGTCATCAAAGG + Intergenic
1029956236 7:104643223-104643245 CAGGAAAGCTTGGTAAAGAAGGG - Intronic
1033121324 7:138669137-138669159 CAAGAAAGCTTTGTTCCAAAAGG + Intronic
1038506280 8:28087792-28087814 CACCAAAGCTTTTTGACCAAGGG - Intergenic
1040459266 8:47631251-47631273 CCCCAAGGCTTTGTAACCATGGG + Intronic
1042404668 8:68390351-68390373 CACGAAATCTTTTGAACAAAAGG + Intronic
1046614632 8:116462671-116462693 CATGAAGGCTTTGTAACATATGG - Intergenic
1048596511 8:135872522-135872544 CCCAAAAGCATGGTAACCAAAGG - Intergenic
1050332031 9:4555352-4555374 CACGAAAGCTTTGTTCTCAGTGG + Intronic
1052520303 9:29538854-29538876 CATCTAATCTTTGTAACCAAAGG + Intergenic
1058502445 9:105634576-105634598 CATGTAAGCTATGGAACCAAAGG + Intronic
1191636471 X:63383224-63383246 CAAGAAAGCTTTGTAAGAACTGG - Intergenic
1193975564 X:88114266-88114288 CCCTAAAGCTTTTTAAACAATGG - Intergenic
1196130648 X:112151829-112151851 CATGAAAACTTTGTGATCAAAGG - Intergenic
1196309480 X:114145717-114145739 CACCAAAACTTTGTGAACAAGGG - Intergenic
1197800162 X:130339886-130339908 CCCGGAAGCATTGAAACCAACGG - Exonic
1199558154 X:149131734-149131756 TACAATAGATTTGTAACCAAAGG - Intergenic
1200860713 Y:7988837-7988859 CACCAAAGCTTTATATACAATGG - Intergenic