ID: 1068037658

View in Genome Browser
Species Human (GRCh38)
Location 10:51781379-51781401
Sequence CTGTTTCCCCAAAGGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068037654_1068037658 23 Left 1068037654 10:51781333-51781355 CCATTGGTTACAAAGCTTTCGTG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1068037658 10:51781379-51781401 CTGTTTCCCCAAAGGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068037658 Original CRISPR CTGTTTCCCCAAAGGCAAGA GGG Intronic
No off target data available for this crispr