ID: 1068037739

View in Genome Browser
Species Human (GRCh38)
Location 10:51782423-51782445
Sequence CTGTATCTTCATATCATACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068037737_1068037739 -10 Left 1068037737 10:51782410-51782432 CCTGTGCCAAGCACTGTATCTTC 0: 1
1: 0
2: 2
3: 27
4: 243
Right 1068037739 10:51782423-51782445 CTGTATCTTCATATCATACGAGG No data
1068037736_1068037739 30 Left 1068037736 10:51782370-51782392 CCTTTCTTTGTGTATACAGGTAA 0: 1
1: 0
2: 5
3: 25
4: 275
Right 1068037739 10:51782423-51782445 CTGTATCTTCATATCATACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068037739 Original CRISPR CTGTATCTTCATATCATACG AGG Intronic
No off target data available for this crispr