ID: 1068041188

View in Genome Browser
Species Human (GRCh38)
Location 10:51826230-51826252
Sequence GCATTTAGAGTAGTGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 323}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068041188 Original CRISPR GCATTTAGAGTAGTGTGCTG TGG (reversed) Intronic
904427762 1:30440947-30440969 GCATTCAAAGCAGTGTGCAGAGG + Intergenic
905843776 1:41208717-41208739 ACATTTAAAGCAGTGTGTTGAGG + Intronic
906828696 1:49008866-49008888 GCATTCAGAGGAGTGTGTAGAGG + Intronic
906854097 1:49285359-49285381 GCATTCAGAGGAGTGTGTAGAGG + Intronic
910698516 1:90047680-90047702 GGTTTGAGAGTAGGGTGCTGAGG - Intergenic
911094489 1:94044540-94044562 GGCTCTAGAGAAGTGTGCTGGGG + Intronic
911168033 1:94742532-94742554 GCATTTATATTAGTGTGCTAGGG + Intergenic
911700521 1:100947209-100947231 ACATTTAAAGCAGTGTGCAGTGG - Intronic
912478478 1:109959068-109959090 GAATTTAGGGTTGTGTGCGGTGG + Intergenic
912608639 1:111019440-111019462 GCATTTGCAGTTGTGTACTGTGG - Intergenic
912736922 1:112157951-112157973 GCATTCAAAGTAGTGTGTAGAGG - Intergenic
913607998 1:120483689-120483711 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
914208441 1:145556469-145556491 GCATTTAAAGTAGTGTGTAGAGG - Intergenic
914369419 1:147009509-147009531 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
914583202 1:149038151-149038173 ACATTTAAAGTAGTGTGTAGAGG - Intronic
915077073 1:153317405-153317427 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
917161200 1:172058684-172058706 GCATTTAAAGCAGTGTGTAGAGG + Intronic
917181702 1:172304871-172304893 GCATTTAAAGCAGTGTGTAGAGG + Intronic
917192683 1:172434592-172434614 GCATTTAAAGCAGTGTGTAGAGG + Intronic
918814487 1:189165430-189165452 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
921358556 1:214308853-214308875 CCCTTTACAGTAGTGTGCTTGGG + Intronic
921835507 1:219774153-219774175 GTAATTAGAGAAGAGTGCTGGGG + Intronic
923296019 1:232595553-232595575 GGAATGAGATTAGTGTGCTGGGG - Intergenic
923853724 1:237823518-237823540 ACATTTAAAGTAGTGTGTAGAGG + Intronic
924060494 1:240169288-240169310 GCATTTTCAGTAGTCTTCTGTGG + Intronic
1064351029 10:14576655-14576677 ACATTTACAGTAGTATTCTGTGG + Intronic
1065657363 10:27965564-27965586 GCATTTAGAGTAGTGTCCATGGG + Intronic
1065898051 10:30181909-30181931 GCATGTAGAGTAATGGGCTTGGG + Intergenic
1066655493 10:37695810-37695832 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1066799111 10:39164393-39164415 GCATTTAAAGCAGTGTGCAGAGG - Intergenic
1067172301 10:43917912-43917934 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
1068041188 10:51826230-51826252 GCATTTAGAGTAGTGTGCTGTGG - Intronic
1068508596 10:57935172-57935194 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1068788865 10:61006019-61006041 GCATTTAAAGCAGTGTGTAGAGG - Intergenic
1069161855 10:65102733-65102755 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1070349570 10:75578904-75578926 ACATTTAAAGTAGTGTGTAGAGG + Intronic
1071900528 10:90116221-90116243 GCATTTAAAGCAGTGTGTAGAGG - Intergenic
1071954626 10:90744260-90744282 GCTTTTAATCTAGTGTGCTGGGG - Intronic
1073166271 10:101455412-101455434 GAATTTACAGTAGTGTGGGGTGG + Intronic
1073647592 10:105321766-105321788 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
1073966376 10:108995202-108995224 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1074016469 10:109539733-109539755 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1074279933 10:112041572-112041594 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1074303463 10:112253886-112253908 GCATTTAAAGCAGTGTGTAGAGG + Intergenic
1074615748 10:115066444-115066466 GCATGTAGGGTAGATTGCTGGGG - Intergenic
1077975725 11:7246546-7246568 GCAATTATAGTAGAGTGGTGAGG - Intronic
1078166665 11:8892230-8892252 ACATTTAAAGCAGTGTGCAGAGG + Intronic
1078284105 11:9933648-9933670 GCATTTAAAGCAGTGTGTAGAGG + Intronic
1078812356 11:14780654-14780676 ACATTTAAAGTAGTGTGTAGAGG + Intronic
1081768523 11:45630567-45630589 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1081936361 11:46906649-46906671 GCAAGTAGAGCAGTGTCCTGGGG + Intronic
1082164357 11:48928005-48928027 GCATTCAAAGCAGTGTGCAGCGG - Intergenic
1082198119 11:49327745-49327767 ACATTTTTAGTAGTGTGCTGTGG - Intergenic
1082876825 11:57997316-57997338 GCATTCAGAGCAGTGTGTAGAGG - Intergenic
1082967917 11:58987070-58987092 ACATTTAAAGTAGTGTGTGGAGG - Intronic
1083494523 11:63039457-63039479 ACATTTAGAGCAGTGTGTAGAGG - Intergenic
1083530987 11:63421692-63421714 ACATTCAAAGCAGTGTGCTGAGG + Intergenic
1083532631 11:63438148-63438170 GCATTCAAAGCAGTGTGCTGAGG + Intergenic
1086085761 11:82953516-82953538 GCATTTAAAGCAGTGTGTAGAGG - Intronic
1086213080 11:84344374-84344396 GGTTTTAGAGTAGTGTACTCAGG + Intronic
1086875185 11:92087213-92087235 GCAGTTAGAATAATATGCTGAGG - Intergenic
1087224436 11:95582097-95582119 GCATTGAGAATAATGTGGTGAGG - Intergenic
1087331826 11:96790654-96790676 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1087372248 11:97300128-97300150 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1087696037 11:101377217-101377239 ACATTTAAAGCAGTGTGCAGGGG - Intergenic
1087911478 11:103759089-103759111 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1088416035 11:109589925-109589947 GCCTTTAGAGAAGTATTCTGGGG + Intergenic
1090465556 11:126930128-126930150 GCATTAAGAAAAGTGTGCAGGGG - Intronic
1090932984 11:131315519-131315541 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1091246879 11:134104346-134104368 ACATTTAAAGTAGTGTGTAGAGG + Intronic
1091329815 11:134723301-134723323 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
1091867534 12:3854124-3854146 ACATTTAAAGTAGTGTGTAGAGG + Intronic
1092084054 12:5741121-5741143 GCATGTAGTGAAGTGTGCTCAGG - Intronic
1094875919 12:34642503-34642525 GCATTCAAAGCAGTGTGCAGAGG + Intergenic
1095695148 12:45135451-45135473 ACATTTAAAGTGGTGTGCAGAGG + Intergenic
1095706193 12:45239699-45239721 ACATTTAAAGCAGTGTGCAGAGG - Intronic
1095827230 12:46543094-46543116 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1095913675 12:47454953-47454975 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1096216523 12:49800865-49800887 TCATTGAGAAGAGTGTGCTGGGG + Intronic
1096957695 12:55543524-55543546 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
1097722151 12:63033436-63033458 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1098053223 12:66475817-66475839 GCATTTAAAGCAGTGTGTAGAGG + Intronic
1098084413 12:66826747-66826769 GCATTTAGAATTTTGTGCTTTGG - Intergenic
1098118623 12:67209700-67209722 GCAATTAAAGTGGTGGGCTGTGG - Intergenic
1098624661 12:72649057-72649079 GCATTTAAAGTAGTCTTTTGTGG - Intronic
1098692023 12:73501187-73501209 GCATTTAAAGCAGTGTGTAGGGG - Intergenic
1100564099 12:95778150-95778172 GCATTTAAAGCAGTGTGTAGAGG + Intronic
1101768403 12:107725097-107725119 GCATTTAAAGCAGTGTGTAGAGG + Intergenic
1102245800 12:111354979-111355001 GCATTTTGAGTAGGGTGCAAGGG - Intergenic
1105227111 13:18446325-18446347 GCATTTGGAATAGTGTGTTTTGG + Intergenic
1105486847 13:20841717-20841739 ACATTTAAAGGAGTGTGGTGGGG - Intronic
1105663633 13:22527717-22527739 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1105735080 13:23259696-23259718 GCATTTAAAGCAGTGTGTAGAGG - Intronic
1108198792 13:48021784-48021806 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1109216326 13:59593609-59593631 ACATTTAAAGTAGTGTGTTGTGG + Intergenic
1109949344 13:69481008-69481030 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
1111008199 13:82276728-82276750 GCATATACAGCAGTGTTCTGGGG - Intergenic
1112482465 13:99789350-99789372 ACATTTAAAGTAGTGTGTAGAGG - Intronic
1114572946 14:23687463-23687485 GCATTTAAAGCAGTGTGCAGAGG - Intergenic
1115719577 14:36145814-36145836 GCATTCAAAGCAGTGTGCAGAGG - Intergenic
1116314807 14:43373118-43373140 GCATTCAAAGCAGTGTGCAGAGG + Intergenic
1116410100 14:44610764-44610786 ACATTTTTAGTAGGGTGCTGAGG - Intergenic
1117236155 14:53778401-53778423 TCATTCTGAGTAGTGTTCTGTGG - Intergenic
1118649108 14:67870925-67870947 GCATTTAAAGCAGTGTGTAGAGG + Intronic
1118938243 14:70308202-70308224 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1124022525 15:25937723-25937745 GAAGTTAGAGGACTGTGCTGAGG + Intergenic
1125237502 15:37532999-37533021 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1125715428 15:41817283-41817305 GCATGTAGAGTAGCTTGATGGGG + Intronic
1126170931 15:45694611-45694633 GCATTGTAAGTAGTGTTCTGTGG + Intergenic
1126476603 15:49071545-49071567 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1126656860 15:50987455-50987477 ACATTTAAAGTAGTGTGTAGAGG - Intronic
1126736473 15:51736958-51736980 AAATATAGAGTAGTGTGATGGGG + Intronic
1127695820 15:61446118-61446140 GCAGTTTTAGTAGAGTGCTGGGG + Intergenic
1127697011 15:61460065-61460087 ACATTTAGAGGAGTGTCCAGAGG - Intergenic
1128350609 15:66885919-66885941 GCACTCAGAGGAGGGTGCTGTGG - Intergenic
1129748048 15:78038672-78038694 GTATTTAGAGTTGGGGGCTGAGG - Intronic
1129963516 15:79711931-79711953 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1131478025 15:92757600-92757622 ACATTTAAAGTAGTGTGTAGAGG + Intronic
1133976813 16:10605077-10605099 ACCTGTAGAGTGGTGTGCTGGGG + Intergenic
1134077438 16:11301730-11301752 CCATTTAAAGTAGGGTGCAGAGG + Intronic
1137379865 16:47987181-47987203 GGTTGGAGAGTAGTGTGCTGAGG + Intergenic
1140206240 16:72935935-72935957 GCATTTTGATGAGAGTGCTGGGG + Intronic
1141496825 16:84416172-84416194 GCTTTTAGAGTAGTGAGGTTTGG + Intronic
1143301407 17:5913281-5913303 GCATTTGGAGCAGTGTGGAGAGG + Intronic
1144480132 17:15622163-15622185 AGATTTAGGGTTGTGTGCTGAGG - Intronic
1144918173 17:18741575-18741597 AGATTTAGGGTTGTGTGCTGAGG + Intergenic
1144999746 17:19295831-19295853 GCACTGACAGCAGTGTGCTGGGG + Intronic
1150908549 17:69364456-69364478 TCATTTAGTGGAGTGTGGTGAGG - Intergenic
1151539112 17:74755682-74755704 GTATTTAGAGGAGTGTGTTTGGG + Intronic
1203191504 17_KI270729v1_random:194204-194226 GCATTCAAAGCAGTGTGCAGAGG + Intergenic
1154526262 18:15293147-15293169 GCATTTGGAATAGTGTGTTTTGG - Intergenic
1155501806 18:26493850-26493872 GCATCTAGGGTAGTGGGCTGGGG - Intronic
1155988060 18:32251633-32251655 GCATTTAGATTATTTTTCTGAGG - Intronic
1156726288 18:40132154-40132176 GCATTTAGAGCAGTGGTCAGAGG + Intergenic
1156799183 18:41088120-41088142 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1157755765 18:50216212-50216234 GCATTTGGAGTTGAGTGTTGGGG - Intergenic
1158446412 18:57526188-57526210 GCAATTAGAGTAGTGTGCCCAGG + Intergenic
1158631160 18:59115491-59115513 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1161426802 19:4208131-4208153 GCATTTAGAGTAGTCTGGGAGGG + Intronic
1163767361 19:19170984-19171006 GGATTTAGAGTTCTGGGCTGGGG - Intronic
1166157334 19:40923703-40923725 GCATTTACATTTGTGTGTTGTGG - Intergenic
1166166193 19:40990728-40990750 GCATTTACATTTGTGTGTTGTGG - Intergenic
1166446341 19:42860686-42860708 GCATTCAAAGCAGTGTGCAGAGG - Intronic
926493181 2:13550885-13550907 GCTTATAGAGTAATATGCTGAGG - Intergenic
927117525 2:19919573-19919595 GCATTTAAAGCAGTGTGTAGAGG + Intronic
928522449 2:32103619-32103641 ACATTTAAAGTAGTGTGTAGAGG - Intronic
930233489 2:48866353-48866375 GCATTTAGAGTTTGGAGCTGAGG - Intergenic
931536833 2:63286893-63286915 GCATTTATAGTAGTCGGCTAAGG + Intronic
932662417 2:73667650-73667672 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
932735005 2:74248294-74248316 GCATTTGGGGCAGTATGCTGGGG - Intronic
935913990 2:107928881-107928903 GCAATTAGAGTAGTTGCCTGAGG + Intergenic
937659153 2:124410718-124410740 GCATTCAGAGCAGTGTGTAGAGG + Intronic
937809210 2:126181193-126181215 GCATTCAAAGTAGTGTGTAGAGG - Intergenic
938525362 2:132124512-132124534 GCATTTGGAATAGTGTGTTTTGG - Intergenic
939298909 2:140306809-140306831 GCATTTAAAGCAGTGTGTAGAGG - Intronic
939731093 2:145785354-145785376 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
939744210 2:145949333-145949355 GCATTTAAAGCAGTGTGTAGAGG - Intergenic
940454630 2:153881116-153881138 ACTTTTAGAGTTGTGTGCTTGGG + Intronic
940891410 2:159039504-159039526 ACATTTAGAGCAGTGTGTAGAGG - Intronic
941430731 2:165410954-165410976 GCTTTTAGAATATTGTCCTGAGG + Intergenic
942836211 2:180301560-180301582 GCATTCAAAGTAGTGTGTAGAGG - Intergenic
943233987 2:185293918-185293940 GCACTTAGAGCAGTGTGTAGAGG + Intergenic
943359356 2:186899231-186899253 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
944312895 2:198254481-198254503 TCATTTCAAGTACTGTGCTGGGG - Intronic
944979551 2:205100214-205100236 CCATTTAGAGTATGGTGCAGAGG + Intronic
945972329 2:216243043-216243065 GCATTTGGAGTGATGTGCTGTGG - Intergenic
948479996 2:238243245-238243267 CCATTTAGAGCAGTTTGCAGAGG + Intergenic
1169446349 20:5674679-5674701 TCATCTAGAGTAGAGTGCAGTGG + Intergenic
1169491384 20:6074139-6074161 GCATTAAGAGCAGTTAGCTGTGG - Intergenic
1169658673 20:7954683-7954705 GCATTTAAAGCAGTGTGTAGAGG - Intergenic
1170072254 20:12381465-12381487 TCATTTAAAGTAGTCTTCTGTGG - Intergenic
1170081143 20:12477939-12477961 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1171094964 20:22323634-22323656 GGATTAAGAGTAATTTGCTGTGG + Intergenic
1171735676 20:28779472-28779494 GCATTCAAAGCAGTGTGCAGAGG - Intergenic
1173543602 20:43874280-43874302 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1176771160 21:13075347-13075369 GCATTTGGAATAGTGTGTTTTGG + Intergenic
1177120680 21:17133247-17133269 GCATATAGAGCAGTCTTCTGGGG - Intergenic
1177142692 21:17375032-17375054 GCATTTAAAGTAGTCTGTAGAGG + Intergenic
1179529149 21:42006579-42006601 ATATTCTGAGTAGTGTGCTGAGG - Intronic
949427871 3:3939015-3939037 ACATTTAAAGTAGTGTGTAGAGG - Intronic
950593823 3:13960372-13960394 ACATTTAAAGTAGTGTGTAGAGG - Intronic
951108151 3:18769749-18769771 GCATTGAGTGTATTGTGCTTTGG - Intergenic
954524100 3:51254019-51254041 ACATTTAAAGCAGTGTGCAGAGG - Intronic
954931645 3:54287915-54287937 GCATTCAGAGCAGTGTGTAGAGG + Intronic
955082259 3:55668660-55668682 GCATTGAGAGCTGTGTGGTGTGG - Intronic
956579489 3:70794560-70794582 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
957160819 3:76607404-76607426 ATATTTTGATTAGTGTGCTGTGG + Intronic
959066113 3:101658629-101658651 TCATTTAGAGTAGTGGTCTCCGG - Intronic
960850161 3:122045070-122045092 GCATTTAAAGCAGTGTGTAGAGG - Intergenic
961163054 3:124745804-124745826 GCCTTTGGAGTGATGTGCTGAGG + Intergenic
962238139 3:133726810-133726832 GCATTCAGAGCAGTGTGTAGAGG - Intergenic
962602542 3:137004919-137004941 ACATTTAAAGCAGTGTGCAGAGG - Intronic
963581089 3:147127348-147127370 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
963874170 3:150455166-150455188 GCATTTAAATTAGTTTGCTTGGG - Intronic
964264430 3:154877946-154877968 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
964450588 3:156809321-156809343 TCATTTAAAGTAGTCTTCTGTGG + Intergenic
964500484 3:157343016-157343038 ACATTTAAAGCAGTGTGCAGAGG + Intronic
967117429 3:186354579-186354601 GCATCTAGAAAAGTCTGCTGTGG - Intronic
968213601 3:196869150-196869172 GTATGTAGAGGAGGGTGCTGGGG + Intronic
970418211 4:15880091-15880113 GCATTTTATGTAGTGTCCTGAGG + Intergenic
974135049 4:57805099-57805121 GCATGTAGATTTGTGTGGTGTGG - Intergenic
974230957 4:59112905-59112927 ACATTTAAAGAAGTGTGCAGAGG - Intergenic
974567172 4:63592591-63592613 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
974690414 4:65291389-65291411 GCATTCAGAGCAGTGTGTAGAGG - Intergenic
974944715 4:68512961-68512983 GCATTTAAAGCAGTGTGTAGAGG - Intergenic
975158962 4:71103760-71103782 GCATTTAAAGCAGTGTGGAGAGG + Intergenic
977218561 4:94312291-94312313 ACATTTAAAGTAGTGTGTAGAGG - Intronic
977561050 4:98534168-98534190 ACATTTAAAGCAGTGTGCAGAGG - Intronic
978213810 4:106172699-106172721 TCATTTAGAGTTATCTGCTGTGG + Intronic
978560167 4:110024747-110024769 GCACTTGGAGGAGTGTGCAGTGG + Intergenic
979445221 4:120804689-120804711 ACATTTAAAGTAGTGTGTAGAGG + Intronic
980552075 4:134351447-134351469 GCAGTTAGAGCAGAGTGATGAGG + Intergenic
981042623 4:140237506-140237528 GTATTTAGAGAAGTGTGCCTGGG - Intergenic
981760755 4:148192490-148192512 TCAGTTGTAGTAGTGTGCTGAGG + Intronic
981795983 4:148596118-148596140 ACATTTAAAGTAGTGTGTGGAGG - Intergenic
982931113 4:161408189-161408211 GCATTTGAAGTTGTGTTCTGTGG - Intronic
983083016 4:163410845-163410867 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
984605649 4:181782773-181782795 ACATTTAAAGCAGTGTGTTGAGG - Intergenic
984673129 4:182515114-182515136 GCAATTTCAGTAGTGTTCTGGGG + Intronic
985166151 4:187096720-187096742 TCTTTTAGAATAGTGTGCTGCGG + Intergenic
986835387 5:11631483-11631505 GCAAAAAGAGGAGTGTGCTGTGG - Intronic
988284120 5:29189739-29189761 GCATTCAAAGTAGTGTGTAGAGG - Intergenic
989012691 5:36891425-36891447 TAATTTAGACTAGTGTGGTGAGG + Intronic
989449251 5:41567683-41567705 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
989452926 5:41607883-41607905 GCATTTAAAGCAGTGTGTAGAGG - Intergenic
989966184 5:50468448-50468470 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
990084241 5:51954719-51954741 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
991487833 5:67156342-67156364 ACATGTAGAGCAGTGTGCTGTGG - Intronic
993366472 5:87040193-87040215 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
994528268 5:100933241-100933263 GCATTTAAAGCAGTGTGTAGAGG - Intergenic
995307348 5:110668967-110668989 ACATTTAAAGCAGTGTGCAGAGG + Intronic
995384952 5:111578667-111578689 GCATTCAAAGCAGTGTGCAGAGG - Intergenic
995810887 5:116106137-116106159 ACATTTAAAGCAGTGTGCAGAGG - Intronic
996459035 5:123719987-123720009 GCATTTAAACTAGTATGCTGTGG - Intergenic
996788565 5:127268072-127268094 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
997042017 5:130267458-130267480 GCATTCAAAGTAGTGTGTAGAGG - Intergenic
997823278 5:137084836-137084858 GCATTTGGAGTGGTGTAGTGAGG - Intronic
999707029 5:154283041-154283063 GCATTCATAGCAGTTTGCTGTGG + Intronic
999894778 5:156019875-156019897 GCATTTAAAGCCCTGTGCTGTGG + Intronic
999965909 5:156809148-156809170 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1003971285 6:11301854-11301876 ACATTTAGAGCAGTGTGTAGAGG + Intronic
1003987830 6:11454802-11454824 ACATTTAGAGCAGTGTGTAGAGG + Intergenic
1005747467 6:28851755-28851777 GCATTTAAAGCAGTGTGTAGAGG + Intergenic
1006857403 6:37144588-37144610 GCATTTAGAGCAGAGAGCTCTGG - Intergenic
1008869826 6:56260179-56260201 TCATTTAGAGTTGTGTCTTGAGG - Intronic
1009314245 6:62198076-62198098 ACATTTAAAGCAGTGTGCAGAGG + Intronic
1009487411 6:64241846-64241868 ACATTTAAAGCAGTGTGCAGAGG - Intronic
1009822998 6:68828513-68828535 GTGTTTAGGGTAGTGTGTTGAGG + Intronic
1010688728 6:78882472-78882494 GTATTTGGAGTAGTGTCATGTGG + Intronic
1010959313 6:82127338-82127360 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
1011086777 6:83549472-83549494 GCATTTAAAGCAGTGTGTAGAGG + Intergenic
1011336724 6:86269680-86269702 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
1013736150 6:113229340-113229362 GCATTTAAAGCAGTGTGCAGAGG + Intergenic
1017409908 6:154157045-154157067 GCATTTGGGGTAGTTTCCTGGGG - Intronic
1021460972 7:20886572-20886594 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1022841904 7:34172717-34172739 GCATTCAAAGTAGTGTGTAGAGG - Intergenic
1022845210 7:34203390-34203412 GCATTCAAAGTAGTGTGTAGAGG - Intergenic
1022900153 7:34800556-34800578 ACATTTAAAGTAGTGTGTAGAGG + Intronic
1022901688 7:34816906-34816928 ACATTTAAAGTAGTGTGTAGAGG + Intronic
1023064951 7:36367639-36367661 GCATTAAGGATAGTATGCTGAGG - Intronic
1024591537 7:50889845-50889867 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1024956079 7:54922497-54922519 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1025146474 7:56509565-56509587 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1025737425 7:64163479-64163501 ACATTTAAAGCAGTGTGCAGAGG + Intronic
1026473064 7:70710821-70710843 GGATTTGGAGCAGTGTGCTCTGG + Intronic
1028412729 7:90548547-90548569 ACATTTAAAGTAGTGTGTAGAGG - Intronic
1028468248 7:91176298-91176320 GCATTTAAAGTAGTGTGTAGAGG + Intronic
1028578758 7:92382728-92382750 ACATTTAAAGCAGTGTGCAGAGG + Intronic
1029286254 7:99468205-99468227 GCAAATATAGTAGTGTACTGCGG + Intergenic
1029951414 7:104590265-104590287 ACATTTAAAGCAGTGTGCAGAGG - Intronic
1030774510 7:113516833-113516855 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1033364956 7:140665777-140665799 GCATTTAAAGCAGTGTGTAGAGG + Intronic
1034138724 7:148796813-148796835 GCATCTAGAGCAGGGTGCGGGGG - Intronic
1036969684 8:13341074-13341096 GGATTTAAAATAATGTGCTGAGG + Intronic
1038068603 8:23988977-23988999 GCCTTTTGACTCGTGTGCTGTGG - Intergenic
1038495407 8:27998583-27998605 GCATATAAATTAGTGTGCTGAGG - Intergenic
1040383624 8:46896935-46896957 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1040942749 8:52849828-52849850 GCATTTAAAGCAGTGTGTAGAGG - Intergenic
1041156072 8:54987994-54988016 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1041910126 8:63080159-63080181 ACATTTAAAGTAGTGTGTAGAGG + Intronic
1042171477 8:65995929-65995951 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
1043157458 8:76801767-76801789 GCATTTTTAGTAATTTGCTGAGG + Intronic
1043330692 8:79114917-79114939 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1043700432 8:83280657-83280679 GCATTTAAAGCAGTGTGTAGAGG + Intergenic
1044798676 8:95931036-95931058 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1044960511 8:97526175-97526197 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
1045794456 8:106026288-106026310 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1045938850 8:107715080-107715102 ACATTCAAAGTAGTGTGCAGAGG - Intergenic
1047473171 8:125199332-125199354 GCATTTAAAGTAGTGTGCAGAGG - Intronic
1047840605 8:128747465-128747487 GCATTCAAAGCAGTGTGCAGAGG + Intergenic
1048382801 8:133882953-133882975 ACATTCAGAATAGTGTTCTGGGG + Intergenic
1048422748 8:134293640-134293662 GTAATTATAGTAGTTTGCTGGGG - Intergenic
1051125185 9:13795509-13795531 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1052437920 9:28453785-28453807 GCTTTTTGAGTCATGTGCTGTGG - Intronic
1053169533 9:35868896-35868918 ACATATGGAGAAGTGTGCTGGGG + Intergenic
1056980495 9:91306158-91306180 GCCTATAGAGTCGTGTACTGGGG - Intronic
1059654852 9:116348243-116348265 GTGTTCAGAGTACTGTGCTGAGG + Intronic
1203690972 Un_GL000214v1:42648-42670 GCATTCAAAGTAGTGTGTAGAGG - Intergenic
1203645323 Un_KI270751v1:61543-61565 GCATTCAAAGTAGTGTGTAGAGG + Intergenic
1185786445 X:2895273-2895295 GCATATAGAGAAGTCTGCTCAGG + Intergenic
1186478060 X:9874208-9874230 GGGTTTAGAGCACTGTGCTGAGG + Intronic
1189525107 X:41811577-41811599 ACATTTAAAGTAGTGTGTAGAGG + Intronic
1191198173 X:57747116-57747138 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1191765401 X:64693121-64693143 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1191833143 X:65436478-65436500 GCATTTAAATTGGTGGGCTGAGG - Intronic
1192049046 X:67706800-67706822 ACATTTAAAGTAGTGTGTAGAGG - Intronic
1192675146 X:73187826-73187848 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1192732982 X:73819625-73819647 GCCTATAGAATACTGTGCTGGGG + Intergenic
1192942566 X:75927989-75928011 GCATTCAGAGCAGTGTGTAGAGG + Intergenic
1193007455 X:76636417-76636439 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
1193435687 X:81472624-81472646 ACATTTAAAGTAGTGTGTAGGGG - Intergenic
1193641239 X:84011835-84011857 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1194761492 X:97801066-97801088 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1195420978 X:104675251-104675273 GCATTTAAAGCAGTGTGTAGAGG - Intronic
1195836081 X:109116160-109116182 GCATTCAAAGCAGTGTGCAGAGG + Intergenic
1195983576 X:110605500-110605522 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1196369780 X:114964392-114964414 GCATTTATAGCAGTGAGCAGAGG + Intergenic
1196511515 X:116517760-116517782 GCATTTAAAGCAGTGTGTAGAGG - Intergenic
1196544295 X:116944432-116944454 GCATTTAAAGCAGTGTGTAGAGG - Intergenic
1196898243 X:120359094-120359116 GAATTAAGAGAAGTGTGCAGAGG - Intergenic
1198431964 X:136576397-136576419 TCAGTTAGAGTAGTGGGCTCGGG + Intergenic
1198646098 X:138808430-138808452 ACATTTAAAGCAGTGTGCAGAGG + Intronic
1198689272 X:139262509-139262531 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1198808945 X:140515574-140515596 CACTTTAGAGTAGTGTGGTGTGG + Intergenic
1199450189 X:147970411-147970433 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1199486105 X:148350058-148350080 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1200839855 Y:7770373-7770395 GCAGCTAGAGAAGTGGGCTGTGG + Intergenic
1200847086 Y:7841561-7841583 ACATTTAAAGTAGTGTGTAGAGG - Intergenic
1201350552 Y:13036046-13036068 ACATTTAAAGCAGTGTGCAGTGG + Intergenic
1201359732 Y:13133650-13133672 GCATTCAAAGTAGTGTGTAGAGG - Intergenic
1201393858 Y:13526868-13526890 GCATTCAAAGTAGTGTGTAGAGG + Intergenic
1201422010 Y:13809868-13809890 ACATTTAAAGCAGTGTGCAGCGG - Intergenic
1201758813 Y:17516847-17516869 GGAGTTTGAGGAGTGTGCTGAGG - Intergenic
1201775925 Y:17665713-17665735 ACATTTAAAGCAGTGTGCAGAGG - Intergenic
1201783585 Y:17748744-17748766 GCATTTAAAGCAGTGTGTAGAGG + Intergenic
1201817968 Y:18157243-18157265 GCATTTAAAGCAGTGTGTAGAGG - Intergenic
1201825631 Y:18240279-18240301 ACATTTAAAGCAGTGTGCAGAGG + Intergenic
1201842742 Y:18389143-18389165 GGAGTTTGAGGAGTGTGCTGAGG + Intergenic
1201971677 Y:19804438-19804460 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1202343338 Y:23892436-23892458 ACATTTAAAGTAGTGTGTAGAGG + Intergenic
1202527430 Y:25777649-25777671 ACATTTAAAGTAGTGTGTAGAGG - Intergenic