ID: 1068041326

View in Genome Browser
Species Human (GRCh38)
Location 10:51828405-51828427
Sequence CAGTCTTTGCTCAGTAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068041326_1068041329 27 Left 1068041326 10:51828405-51828427 CCTGTGTTACTGAGCAAAGACTG 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1068041329 10:51828455-51828477 AATTACTTGTTAATTGCAAAGGG No data
1068041326_1068041328 26 Left 1068041326 10:51828405-51828427 CCTGTGTTACTGAGCAAAGACTG 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1068041328 10:51828454-51828476 AAATTACTTGTTAATTGCAAAGG No data
1068041326_1068041330 28 Left 1068041326 10:51828405-51828427 CCTGTGTTACTGAGCAAAGACTG 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1068041330 10:51828456-51828478 ATTACTTGTTAATTGCAAAGGGG No data
1068041326_1068041331 29 Left 1068041326 10:51828405-51828427 CCTGTGTTACTGAGCAAAGACTG 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1068041331 10:51828457-51828479 TTACTTGTTAATTGCAAAGGGGG No data
1068041326_1068041327 3 Left 1068041326 10:51828405-51828427 CCTGTGTTACTGAGCAAAGACTG 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1068041327 10:51828431-51828453 ACAGCATTTAAAGTTGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068041326 Original CRISPR CAGTCTTTGCTCAGTAACAC AGG (reversed) Intronic
900292913 1:1931709-1931731 GAGTCTTTGCTCTGTCACCCAGG - Intronic
901252081 1:7786707-7786729 CACTGTTTGCTAAGAAACACAGG - Exonic
901648737 1:10730490-10730512 CACTCTCAGCTCAGTCACACGGG - Intronic
902979247 1:20111246-20111268 AAGTCTTCTCTCAGTGACACTGG - Intergenic
903346183 1:22685663-22685685 CAGTTTTTGCTCAGCAAGGCTGG + Intergenic
904740603 1:32672487-32672509 CAGTCTGCGATCAGTACCACTGG - Exonic
907791940 1:57675132-57675154 CAGTCTCTGTTCCCTAACACTGG + Intronic
908115869 1:60939776-60939798 AAGTCTTTTCTCTGTATCACAGG - Intronic
909823561 1:80097675-80097697 GAGACTTTGCCCAGTAACTCAGG - Intergenic
911271677 1:95809181-95809203 CAGTCTTTGCTCAGTTAACATGG - Intergenic
912683532 1:111743999-111744021 CAGTCTCTGCTCAGCACCTCTGG - Intronic
913357701 1:117941896-117941918 CAGTTTTTTTTCAGTAACATGGG - Intronic
918092345 1:181308327-181308349 CACTCTTTGCTGTGTAAAACTGG - Intergenic
918969237 1:191392991-191393013 GAGTCTTTGTTCTGTTACACTGG - Intergenic
920198694 1:204245953-204245975 CAGTCTTGGTTCAGAAACTCGGG - Intronic
924334430 1:242973115-242973137 CATTCTTTGCTGAGAAGCACGGG + Intergenic
1063347453 10:5325201-5325223 CAGTCTTTGCTCTGCCTCACTGG - Intergenic
1064424391 10:15217661-15217683 GAGTCTTTGCTCTGTCACCCAGG + Intronic
1064935750 10:20677453-20677475 CAGTGTTTGCTCACCATCACAGG + Intergenic
1064968418 10:21038476-21038498 CAGTCTTAGCAAACTAACACAGG - Intronic
1065552272 10:26879929-26879951 CAGTCTTTCCTCTGTAGGACTGG - Intergenic
1065911432 10:30309566-30309588 CAGTGTTTGCTTATTTACACAGG + Intergenic
1068041326 10:51828405-51828427 CAGTCTTTGCTCAGTAACACAGG - Intronic
1071564554 10:86665080-86665102 CTGTGTTTGCACAGTCACACAGG - Intronic
1072778522 10:98225864-98225886 AAGTCTTGGCTCGGTAACCCAGG + Intronic
1072877203 10:99185276-99185298 GAGTCTTTGCTCTGTCACCCAGG - Intronic
1074215893 10:111383447-111383469 CAGTCTTGGCTCATTATCCCAGG - Intergenic
1074752956 10:116604712-116604734 GAGTCTTTGCTCTGTCACCCAGG + Intronic
1078125624 11:8559175-8559197 TAGTTTTTGCTCAGGAATACAGG + Intronic
1082189222 11:49222270-49222292 CTGTCTTTCCTCGGTATCACAGG - Intergenic
1083039390 11:59670812-59670834 TAGTCTTTGCTCTGTCACCCAGG - Intergenic
1084530855 11:69726996-69727018 CAGTTTTCCCTCAGAAACACAGG - Intergenic
1086220946 11:84442404-84442426 CATTCTTAGCAAAGTAACACAGG + Intronic
1086677298 11:89624397-89624419 CTGTCTTTCCTCGGTATCACAGG + Intergenic
1087117341 11:94539886-94539908 CTGTCTCTGGTGAGTAACACTGG + Intergenic
1087210905 11:95445995-95446017 CAAGTTTTGCTCAGGAACACAGG + Intergenic
1087537069 11:99462606-99462628 CAGTCTTTGCTGAGTGACAAAGG - Intronic
1087906219 11:103700663-103700685 CAGTCTTTCCTTAGTCACAGAGG - Intergenic
1088646691 11:111923025-111923047 CAGGCTCTGTTCACTAACACTGG + Intronic
1089487949 11:118861706-118861728 GAGTCTTTGCTCTGTCACCCAGG + Intergenic
1092502146 12:9058899-9058921 CTTTCTTTATTCAGTAACACTGG - Intergenic
1094770359 12:33651180-33651202 CTGTCTATGCTCAGTAGCATTGG + Intergenic
1095044549 12:37486641-37486663 GAGCCTTTACTCAGTAATACTGG - Intergenic
1096945146 12:55397981-55398003 CTGACTTTGCTCAGTGATACAGG - Intergenic
1097125477 12:56771114-56771136 CAGTCTTTGCTCAGGCTCATGGG + Intronic
1098526280 12:71490725-71490747 GAGTCCTGGCTCAGGAACACAGG - Intronic
1100905041 12:99287333-99287355 CACTCCATGCTCAGTAACACTGG - Intronic
1102506517 12:113387766-113387788 CAGGCTTTGCACAGTGACAGAGG - Exonic
1102804678 12:115769263-115769285 CAGTCATTGCACAGTAAGGCAGG + Intergenic
1103102822 12:118194770-118194792 GAGTCTTTGCTCTGTCACCCAGG + Intronic
1104538643 12:129642185-129642207 CAGTCTTTGAACAGTCACAAGGG + Intronic
1105433797 13:20360407-20360429 CACTGATTGCTCAGTAACATGGG + Intergenic
1105821873 13:24087268-24087290 CAGGCTTTGCTCAGGAACTCAGG - Intronic
1109072792 13:57789649-57789671 GAGTCTTTGCTCTGTCACCCAGG - Intergenic
1110961105 13:81627355-81627377 CATTCTTAGCAAAGTAACACAGG - Intergenic
1112348852 13:98615821-98615843 CAGTGTTTGCTCTGTTACCCAGG - Intergenic
1113905171 13:113815993-113816015 CAGTCACTGCTCAGGGACACGGG + Exonic
1113905182 13:113816069-113816091 CAGTCACTGCTCAGGGACACGGG + Exonic
1114323271 14:21564816-21564838 CAGTCCATGATCAGTACCACTGG - Intergenic
1114402357 14:22421558-22421580 CAGTCTGTTCCCAGTCACACTGG + Intergenic
1115585240 14:34804865-34804887 CAGTCTATGCTCACCAAAACTGG + Intronic
1116218221 14:42048052-42048074 AATTCTTTGCTCACTATCACAGG + Intergenic
1116427819 14:44811491-44811513 CTGTTTTAGCTCAGAAACACTGG + Intergenic
1117309891 14:54510449-54510471 CAGTCTGTGCACTGTAGCACAGG - Intronic
1122025997 14:98876784-98876806 CAGACTTTGCTCATTTACATGGG - Intergenic
1122294326 14:100696796-100696818 CAGTCTGTGCACAATCACACGGG - Intergenic
1123706385 15:22954028-22954050 CAGTCTTCGCTCTGTCACCCAGG - Intronic
1123789619 15:23707884-23707906 CAGTTATTTCTCAGTAACTCAGG + Intergenic
1124080519 15:26490505-26490527 CAGTCTTTGCTCTGTCGCCCAGG + Intergenic
1124811062 15:32938501-32938523 GAGTCTTTGCTCTGTCACCCAGG - Intronic
1124905829 15:33867692-33867714 TTGTCTTTGCCCAGCAACACAGG + Exonic
1127752768 15:62062015-62062037 CAGTCTATTCTCATGAACACCGG + Intergenic
1128135284 15:65258616-65258638 TAGTCTTTGCTGAGTAAAAGGGG - Exonic
1131474749 15:92728241-92728263 GAGTCTTTGCTCAGTTGCCCAGG - Intronic
1134555707 16:15162228-15162250 CACTCTTTTCTCAGTATCACTGG - Intergenic
1134916289 16:18073939-18073961 CACTCTTTTCTCAGTATCACTGG - Intergenic
1135996477 16:27253220-27253242 CAGCCATTGGTCAGAAACACAGG + Intronic
1138664089 16:58548651-58548673 CATTCTTTGCTCAATAACTTGGG - Intronic
1139443892 16:66984858-66984880 CAGTCTTTTCTCAGAAAGCCTGG - Intergenic
1142438025 16:90075620-90075642 CAGTGTCTGCTCAGTTAAACAGG - Intronic
1146377505 17:32304421-32304443 CAGGCTTTGGTCAAGAACACGGG + Intronic
1146602042 17:34225768-34225790 CTGTCTATGCTAAGTAAGACGGG - Intergenic
1147913115 17:43869539-43869561 GAGTCTTTGCTCTGTCACCCAGG - Intergenic
1149602678 17:57903423-57903445 CAGTCTTTGCTCAAGAACAAAGG - Intronic
1150301705 17:64052793-64052815 CAGTCTTCGCTCAGCATCTCTGG + Exonic
1151393689 17:73804903-73804925 CAGTAGGTGCTCAGCAACACTGG - Intergenic
1152189727 17:78881155-78881177 GAGGGTTTGCTCAGTATCACTGG + Intronic
1153249378 18:3105897-3105919 TATTCTTTGCTCAGTAACTGAGG - Intronic
1154389411 18:13923565-13923587 CAGCCACTGCTCAGTGACACAGG - Intergenic
1154488568 18:14900554-14900576 AAGTCTTTGCTCAGTAAGTTGGG - Intergenic
1156076439 18:33284130-33284152 CAGCCTTTGCAAACTAACACAGG + Intronic
1156808827 18:41222641-41222663 CATTTTGTGCTCAGTCACACTGG - Intergenic
1157763039 18:50278377-50278399 CTGTCTTTGATCTGTAACCCAGG + Intronic
1158521636 18:58176036-58176058 CAGTCTTTGCTCAGTGATTCCGG - Intronic
1160702389 19:514134-514156 CAGTGGGTGCTCAGTAATACAGG - Intronic
1160702413 19:514297-514319 CAGTGGGTGCTCAGTAATACAGG - Intronic
1161382512 19:3973197-3973219 CAGTCTTTGCTCTGTCACCCAGG - Intergenic
1161382671 19:3974269-3974291 CAGTCTTTGCTCTGTCACCCAGG - Intergenic
1161747002 19:6066783-6066805 CATTGTTTGCTAAGTAACAACGG + Intronic
1162815338 19:13190880-13190902 CAGTCTTAACTCTGTCACACAGG + Intergenic
1163316388 19:16542998-16543020 CACTCTTTGGTCAGGAAGACTGG + Intronic
1168255692 19:55163664-55163686 CAGTCATCCCTCAGTAACACTGG - Intronic
925467066 2:4115568-4115590 CATTCTCAGCTCACTAACACAGG - Intergenic
925512326 2:4641679-4641701 CCGTCTTTGCTCAGAAACACTGG + Intergenic
926314992 2:11703035-11703057 CACTATTTGCTCAGTAAGAAAGG + Intronic
926531633 2:14054199-14054221 CAGACTTCCCTAAGTAACACTGG - Intergenic
928073630 2:28242442-28242464 CAGGCTTTGCTCAGTGAGACAGG + Intronic
928483071 2:31703306-31703328 CAGTGTTTGCTAAGTAAGAGTGG + Intergenic
928749608 2:34456874-34456896 TAGTCTTTGCCTAGTAATACAGG - Intergenic
934014556 2:87865799-87865821 CAGTCTTTGCTCAGGCAGAATGG - Intergenic
934912612 2:98273204-98273226 CAGTCTTTGCCAAGTGATACTGG + Intronic
938318235 2:130344759-130344781 CAGTCCTTCCTCAGACACACCGG + Intronic
942008529 2:171734570-171734592 CATCCTTTGTACAGTAACACTGG - Intronic
942068102 2:172291001-172291023 CAGTCCCTGCTCACAAACACAGG - Intergenic
944098132 2:195993078-195993100 CAGTCCTTTCCCAGTAACAGAGG + Intronic
945550354 2:211213937-211213959 CAGGCTTTACTTAGTAAGACAGG - Intergenic
946868004 2:224059745-224059767 CAGTCATTTGTCAGTAATACTGG - Intergenic
947065461 2:226219312-226219334 GAGTCTGTGCTCTGTACCACAGG - Intergenic
947137168 2:226987053-226987075 CATTCTCAGCACAGTAACACAGG + Intronic
947524097 2:230868129-230868151 CAGTTTTTGCTCAGAAGCAGGGG - Intronic
948115399 2:235491609-235491631 CAGCCCTTGCTGGGTAACACAGG + Intergenic
1171091008 20:22285782-22285804 CATTCTTTGCTGAGCAATACGGG + Intergenic
1171411904 20:24953191-24953213 CAGTAGATGCTCAGAAACACGGG + Intronic
1171517886 20:25751966-25751988 CAGTGTCTGCTCTGTAAAACAGG + Intergenic
1171539091 20:25930247-25930269 GAGCCTTTACTCAGTAATACTGG - Intergenic
1174234930 20:49081791-49081813 ATGTCTTTGCCCAGTAACAATGG + Intronic
1174807180 20:53614969-53614991 GAGTCTTTGCTCTGTCACCCAGG + Intergenic
1175006469 20:55688516-55688538 GAGTCTTTGCTCTGTCACCCAGG - Intergenic
1177597763 21:23267660-23267682 CTGTCTTTGGTCAGAGACACTGG + Intergenic
1177678188 21:24329954-24329976 CAGTCTTTGCCCATTAACCTTGG + Intergenic
1178425721 21:32477460-32477482 CAGTTCTTGCTCAGTCTCACGGG + Intronic
1181621146 22:24092080-24092102 TTGTCTTTCCTCACTAACACAGG + Intronic
1181844909 22:25699265-25699287 CTGTCTTTTCTCAGGCACACGGG + Intronic
1182899008 22:33882561-33882583 CAGCCTCTCATCAGTAACACTGG + Intronic
1183369591 22:37425002-37425024 CAGTCTCTCCTCTGTAACATGGG - Intronic
949203629 3:1411257-1411279 CAGCCTTAGCAAAGTAACACAGG - Intergenic
950611272 3:14128250-14128272 CAGGCTTTGGTCAATAACAGAGG - Intronic
952412129 3:33058910-33058932 CAGTTTGTGCTCAATAACATCGG + Intronic
953158672 3:40398140-40398162 CAGACTTTGCTCTGTGAGACTGG - Intronic
954333029 3:49900936-49900958 CAGTGTTTGCCCAGCAACTCTGG - Intronic
955918161 3:63926930-63926952 CAGTCTTAGCCAACTAACACAGG - Intronic
956625101 3:71259116-71259138 CAGTCTTAGCTCTGTCACCCAGG - Intronic
958098576 3:88979293-88979315 CAGTCATTGCTCAGTAACCATGG - Intergenic
958434052 3:94076159-94076181 CAGTCTGCGATCAGTACCACTGG + Intronic
958740013 3:98057800-98057822 CAGTCTTTCCTGCATAACACTGG + Intergenic
958996209 3:100908088-100908110 GAGTCTTTGCTCTGTCACCCAGG - Intronic
960609611 3:119543480-119543502 CAGTCTTTGCTCTGTCACCAAGG + Intronic
963085222 3:141429867-141429889 CTGCCTTTGCTCAGGCACACAGG - Intronic
965559637 3:170049121-170049143 CAGGCTCCCCTCAGTAACACCGG + Intronic
965736472 3:171826037-171826059 CACTCTGTGCTCACTAACAAAGG - Intergenic
965915965 3:173846234-173846256 AAGTCTTCACTCAGTAAGACTGG - Intronic
969211312 4:5689664-5689686 CATTGTTTGCTTGGTAACACTGG - Intronic
970695721 4:18674601-18674623 TTGTCTTTTCTCAGTAACAATGG - Intergenic
970814050 4:20132000-20132022 CAGTCATTTCTCAGTAACTGAGG + Intergenic
971554967 4:28002198-28002220 CTGTCTCTGCTGAGTCACACAGG + Intergenic
971634386 4:29037668-29037690 CATTGTTTGCTCTGGAACACAGG - Intergenic
975800620 4:78056751-78056773 CAGTTCTTGCTCAGGCACACCGG - Intergenic
977811299 4:101358660-101358682 CAGTCTTTTCTCTGGAAAACAGG + Intergenic
980997634 4:139795614-139795636 CATTCTTTTCTCCATAACACTGG + Intronic
981161524 4:141504592-141504614 CAGTTTTTGTTCAGAAAAACTGG - Intergenic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
982840922 4:160185231-160185253 GAGTCTTTGCTCTGTCACCCAGG + Intergenic
982976311 4:162066697-162066719 CATTCTTAGCAGAGTAACACAGG - Intronic
982977517 4:162084649-162084671 CATTCTTAGCAGAGTAACACGGG + Intronic
983488271 4:168357495-168357517 CAATCTCTGCTCACTACCACTGG - Exonic
984713873 4:182908352-182908374 AAGTCTTTGCTTAGAAACACAGG - Intronic
985920947 5:2973105-2973127 CAGTCATTGCTCAGTATCCTGGG + Intergenic
987124330 5:14797375-14797397 CGGTCTGTGATCAGTACCACTGG + Intronic
987925514 5:24336061-24336083 AATTCTTTGCTCACTATCACAGG - Intergenic
988203220 5:28097018-28097040 CAGTCTTTGCTGTGTCACCCAGG - Intergenic
988220140 5:28333929-28333951 CTGTCTCTGCACAGTAACAGTGG + Intergenic
989325965 5:40195347-40195369 CAGTCTTTACTCTCTAACACTGG + Intergenic
991445911 5:66699636-66699658 CAGTCTTAGCAGACTAACACAGG + Intronic
993227824 5:85190866-85190888 CAGTCTGTAATCAGTACCACCGG + Intergenic
993292686 5:86095639-86095661 CAGGCCTTGCTCAGCCACACTGG + Intergenic
993557956 5:89365682-89365704 CAGTCTCTGCTGAGCAACCCTGG + Intergenic
994034024 5:95178098-95178120 CTGCCTTTGCTGAGTCACACAGG - Intronic
996700230 5:126443644-126443666 CTGTCTTTTCTCAGTAAAACTGG + Intronic
997664860 5:135622178-135622200 CACTCTGTCCTCAGTATCACTGG - Intergenic
997798352 5:136834178-136834200 CTGTCTCTGCTGAGTCACACAGG + Intergenic
997799431 5:136844921-136844943 CAGTCTTAGCTCAGTCACTGTGG + Intergenic
1000450280 5:161377453-161377475 TACTCTTTTCTCAGTAATACAGG - Intronic
1000654859 5:163864691-163864713 GCGTCTTTGCTTAGCAACACAGG - Intergenic
1002298317 5:178243586-178243608 CAGTCAATGCTCAGTGACAGAGG + Intronic
1002663549 5:180806867-180806889 CAGTCTTTGCTTAGACACAGGGG - Intronic
1005750774 6:28880425-28880447 TAGGCTTTGCTCAGGAACCCAGG - Intergenic
1006100193 6:31681615-31681637 CAGTCTTGACTCAGAAACTCAGG + Intronic
1006900989 6:37500972-37500994 CAGTCAGTGCTCTGTAACAGGGG - Intergenic
1006945663 6:37783151-37783173 GAGTCTTTGCTCAGGGACAGGGG + Intergenic
1008211857 6:48734727-48734749 TAGTCTTTGATCTGTAACACAGG + Intergenic
1008321924 6:50124933-50124955 CAGTTTCTGCACAGAAACACTGG - Intergenic
1008638248 6:53434095-53434117 CAGTCACAGCTCAGTAACATTGG - Intergenic
1009954211 6:70433098-70433120 CAGTCTTTGCTCTGTCGCCCAGG + Intronic
1010161158 6:72857428-72857450 CAGTCTTTGCACAGTAAAATGGG - Intronic
1010782826 6:79965096-79965118 AATTCTTTGCTCAGTATCACAGG + Intergenic
1014777777 6:125530187-125530209 GAGTATTTGCTCAATAACCCAGG + Intergenic
1015198445 6:130551173-130551195 CACTTTTTGCTCAGTGACAAAGG - Intergenic
1019811218 7:3166474-3166496 GAGTCTTTGCTCTGTCACCCAGG + Intronic
1021635470 7:22688226-22688248 GAGTCCTTTCTCAGTAACAAGGG + Intergenic
1022303322 7:29122130-29122152 CAGTCGTTTTTCTGTAACACTGG - Intronic
1023578535 7:41656331-41656353 CCTTCTTTGCTCAGTATTACAGG - Intergenic
1024606599 7:51027282-51027304 CTGTCATTCTTCAGTAACACAGG - Intronic
1025290476 7:57716183-57716205 GAGCCTTTACTCAGTAATACTGG - Intergenic
1026369376 7:69683545-69683567 TAGTTTTTGCTCTGTCACACAGG - Intronic
1026508718 7:71009507-71009529 CAGTCTTTGATCAGTTTGACTGG + Intergenic
1026523403 7:71134782-71134804 CAGGCTTTTCTCAGGGACACAGG + Intronic
1028392459 7:90332675-90332697 CATTCTTTTTTCAGGAACACAGG + Intergenic
1028501824 7:91527599-91527621 CTGTCTCTGCTGAGTCACACAGG - Intergenic
1028619551 7:92809970-92809992 CATCCTTTTCTCAGTAACGCAGG + Intronic
1028696912 7:93724264-93724286 CAGTCCTAGCTGAGTAATACAGG + Intronic
1030238615 7:107294044-107294066 GAGTCTTTGCTCTGTCACCCAGG - Intronic
1033453189 7:141479643-141479665 TCATTTTTGCTCAGTAACACAGG - Exonic
1037586609 8:20281037-20281059 CCGTCTTTGCTGAGTAGCTCAGG - Intronic
1038304964 8:26391753-26391775 CAGTCTGTGATCTGTAACACAGG - Intronic
1040597358 8:48852116-48852138 CAGTCTTTTCTCAGCATCCCTGG + Intergenic
1042462197 8:69082677-69082699 CAGTCTTTCCTCAGTACCTGTGG + Intergenic
1042521939 8:69722143-69722165 GAGTCTTTGCTCTGTCACCCAGG - Intronic
1043179941 8:77076268-77076290 CAGTCTCTGCAAACTAACACAGG + Intergenic
1044417721 8:91954936-91954958 CAGTCTATTCTCAGTCACACTGG - Intergenic
1044589945 8:93904451-93904473 CAGTCTTGGCTAAGTAATAGGGG + Intronic
1052635098 9:31093046-31093068 TATTCTTAGCACAGTAACACAGG + Intergenic
1052968457 9:34361319-34361341 CAGTCATTGCTCAGTAAAAACGG + Intergenic
1054165958 9:61729185-61729207 GAGCCTTTACTCAGTAATACTGG + Intergenic
1055812851 9:80170511-80170533 GAGTCTTTGCTCTGTCACCCAGG + Intergenic
1056773535 9:89496522-89496544 CAGTCTTTGCTCACAGAAACAGG + Intronic
1057951793 9:99375005-99375027 CAAAGTTTGCTAAGTAACACTGG - Intergenic
1059934638 9:119297376-119297398 CAGTCTGTGCTCGTTACCACTGG - Intronic
1185637858 X:1567792-1567814 CAGTCATCCCTCAGTAACATTGG + Intergenic
1186447130 X:9640654-9640676 GAGTCTTTGCTCTGTCACCCAGG + Intronic
1190856863 X:54304513-54304535 CAGTGTTTGCTCTGTCACCCAGG - Intronic
1191797675 X:65038721-65038743 CAGTCTCTGTTAAGTAACATAGG + Intergenic
1192664652 X:73076812-73076834 CAGTATTTTCTCAGGGACACAGG - Intergenic
1195801153 X:108712473-108712495 AAGTCTTTGCTCAGTTAAATTGG + Intergenic
1196466603 X:115978244-115978266 CATTCTTTCCTCCATAACACAGG + Intergenic
1196569802 X:117252554-117252576 CATTCTTAGCAAAGTAACACAGG - Intergenic
1198734403 X:139770700-139770722 CAGTCTTTACTTACTTACACAGG - Intronic
1199129921 X:144172712-144172734 CAGTCTTTGCTCAGGCAGAATGG + Intergenic
1199619000 X:149682668-149682690 CTTTCTTTGCTTAGGAACACAGG + Intergenic
1199876059 X:151929398-151929420 CAGACTTTGCACAGGACCACTGG - Intergenic