ID: 1068042123

View in Genome Browser
Species Human (GRCh38)
Location 10:51838567-51838589
Sequence TTACTTGGAAAGTGTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068042121_1068042123 6 Left 1068042121 10:51838538-51838560 CCTTTTTTAAGTCAAAGATAGAA 0: 1
1: 1
2: 7
3: 323
4: 623
Right 1068042123 10:51838567-51838589 TTACTTGGAAAGTGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068042123 Original CRISPR TTACTTGGAAAGTGTCCTGC AGG Intronic
No off target data available for this crispr