ID: 1068042366 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:51841239-51841261 |
| Sequence | CATTCATCATTTATTGAACA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1068042365_1068042366 | -3 | Left | 1068042365 | 10:51841219-51841241 | CCTGTGTGATTTAGTTTATTCAT | 0: 1 1: 0 2: 2 3: 21 4: 385 |
||
| Right | 1068042366 | 10:51841239-51841261 | CATTCATCATTTATTGAACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1068042366 | Original CRISPR | CATTCATCATTTATTGAACA TGG | Intronic | ||
| No off target data available for this crispr | |||||