ID: 1068042366

View in Genome Browser
Species Human (GRCh38)
Location 10:51841239-51841261
Sequence CATTCATCATTTATTGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068042365_1068042366 -3 Left 1068042365 10:51841219-51841241 CCTGTGTGATTTAGTTTATTCAT 0: 1
1: 0
2: 2
3: 21
4: 385
Right 1068042366 10:51841239-51841261 CATTCATCATTTATTGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068042366 Original CRISPR CATTCATCATTTATTGAACA TGG Intronic
No off target data available for this crispr