ID: 1068044707

View in Genome Browser
Species Human (GRCh38)
Location 10:51871541-51871563
Sequence CAGCACTGACAGCTTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068044707_1068044713 -7 Left 1068044707 10:51871541-51871563 CCAGCCCCAAGCTGTCAGTGCTG 0: 1
1: 0
2: 4
3: 26
4: 281
Right 1068044713 10:51871557-51871579 AGTGCTGTGACACATTTGGTGGG No data
1068044707_1068044712 -8 Left 1068044707 10:51871541-51871563 CCAGCCCCAAGCTGTCAGTGCTG 0: 1
1: 0
2: 4
3: 26
4: 281
Right 1068044712 10:51871556-51871578 CAGTGCTGTGACACATTTGGTGG No data
1068044707_1068044714 5 Left 1068044707 10:51871541-51871563 CCAGCCCCAAGCTGTCAGTGCTG 0: 1
1: 0
2: 4
3: 26
4: 281
Right 1068044714 10:51871569-51871591 CATTTGGTGGGAGAATCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068044707 Original CRISPR CAGCACTGACAGCTTGGGGC TGG (reversed) Intronic
900102900 1:970412-970434 CAGCACAGCCAGGTGGGGGCCGG + Exonic
900892290 1:5458271-5458293 CAGCTCTGATAGCTTGAAGCTGG - Intergenic
901663409 1:10813083-10813105 CAGCACTGGCAGCCAAGGGCTGG + Intergenic
901878115 1:12178665-12178687 CAGCACTGCCAGGTCGGGGGTGG + Intronic
902694469 1:18130958-18130980 CAGCTCTGACAGCCTCGGGCCGG + Intronic
902774688 1:18667159-18667181 CAGCACACACAGCTAGGGTCAGG - Intronic
902947972 1:19856922-19856944 CAGCACTGACCACTTGGAACAGG - Intergenic
903943171 1:26945557-26945579 CAGGTCTGACAGCTGAGGGCAGG - Exonic
905095253 1:35464772-35464794 CAGCACTGAGAACCTGGGCCTGG - Intronic
905223848 1:36466771-36466793 CAGCACTGTGAGCTTGGTGATGG + Exonic
905684267 1:39897641-39897663 CAGAACTGACAGGTTTGGGGTGG + Exonic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
907386918 1:54131968-54131990 CAACACTGACACCATGTGGCAGG + Intergenic
907469685 1:54665254-54665276 CAGCACAGTCAGCTAGGGGTTGG - Intronic
909051523 1:70773918-70773940 TAGCTCTGACAGCATGTGGCTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
909634580 1:77802698-77802720 CAGCACTGACGTCCTGGGTCAGG - Intronic
909673254 1:78212046-78212068 CAGCAGTGTCATCATGGGGCAGG - Intergenic
911689358 1:100814582-100814604 CTGCACTGACAGCTCTGGACAGG + Intergenic
912797730 1:112702993-112703015 CAGCCCTGACAGCCTGGGTGAGG - Exonic
915367363 1:155323645-155323667 CAGCAGTGCCAGCTCGGGGCTGG - Intronic
916412553 1:164559892-164559914 CAGCACTTGCAGGATGGGGCCGG + Exonic
917450993 1:175147107-175147129 CAGCTGTGGCAGCTTGGGGCGGG + Exonic
917660611 1:177173573-177173595 CTGCTCTGTCAGCATGGGGCTGG + Intronic
917978171 1:180253364-180253386 CAGCACAGACCTCTTGGAGCTGG + Intronic
919687056 1:200493567-200493589 CAGCTGTGACAGCTGGGAGCAGG + Intergenic
919743145 1:200992462-200992484 CAGCTCTGAGGGCATGGGGCAGG + Intronic
920069055 1:203289533-203289555 CAGCACCCAGAGCTTGGGGATGG + Intergenic
920691933 1:208153840-208153862 CAGAACAGACAGCTGGGGGAGGG + Intronic
921266496 1:213424997-213425019 CAGCGATGTGAGCTTGGGGCAGG - Intergenic
921527979 1:216241778-216241800 CAGCACTGAGAGGCTGAGGCGGG - Intronic
923361134 1:233212184-233212206 AAGCAAGGACAGCTGGGGGCGGG + Intronic
1062828075 10:586919-586941 CCCCACTGACAGCATGGGGAGGG + Intronic
1064873564 10:19966987-19967009 TAGCACTGACAGAGAGGGGCTGG - Intronic
1065126817 10:22581863-22581885 CAGCACTGGGAGGTTGAGGCAGG + Intronic
1067078223 10:43199984-43200006 CAGCACAGCCATCTTGGAGCAGG + Intronic
1067753458 10:48986583-48986605 CAGCACTGACAGCAGCAGGCTGG + Intergenic
1068044707 10:51871541-51871563 CAGCACTGACAGCTTGGGGCTGG - Intronic
1069554091 10:69385483-69385505 CAGCCCTGACAGCATGGAGCTGG - Intronic
1069692666 10:70364096-70364118 CAGCTCTGAGAGCATGGGGGAGG - Intronic
1070581033 10:77719709-77719731 CAGCAATGGCAGCATAGGGCTGG - Intergenic
1071966362 10:90857122-90857144 CAGCATTGACAGGTAAGGGCCGG - Exonic
1072641432 10:97213990-97214012 AATCACTGGCAGCCTGGGGCAGG + Intronic
1073108444 10:101046913-101046935 CAGTAGTCACAGCTTGGAGCAGG - Intergenic
1073455775 10:103635921-103635943 CAGCACTTCCAGCTCAGGGCAGG + Intronic
1075158978 10:120006137-120006159 CAGCATTAACCCCTTGGGGCTGG + Intergenic
1075978373 10:126716487-126716509 CACCACTGTCAGCTGTGGGCTGG - Intergenic
1076133286 10:128028389-128028411 CAGCAATTCCAGCCTGGGGCGGG - Intronic
1077339908 11:2021632-2021654 GAGCACTGCCAGCGTGGGGGTGG - Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1077735099 11:4782731-4782753 CAGCACAGAGACCTTGGGCCTGG - Intronic
1078329822 11:10409914-10409936 CAGCAGTGTCAGCTTAGGCCAGG - Intronic
1079444530 11:20546866-20546888 CAGAGCTGACAGCTTGGGCAAGG + Intergenic
1082821281 11:57546138-57546160 GAGGACTGACACCTGGGGGCTGG + Intronic
1082865847 11:57899512-57899534 CTGGACTGCCAGCTTGGTGCAGG + Intergenic
1084019753 11:66410443-66410465 CTGCACTGAGGGCTTGGCGCTGG - Intergenic
1084654651 11:70508116-70508138 CCGCACTGACAGCCTGTGCCCGG + Intronic
1085829578 11:79885129-79885151 CACCACTGACATTTTAGGGCAGG - Intergenic
1086076408 11:82857877-82857899 CAGCACTGCCAAGGTGGGGCAGG - Intronic
1088356341 11:108948006-108948028 CATCACAGACAGGATGGGGCAGG - Intergenic
1088655502 11:111995480-111995502 CACTATTGACAGCTTGGAGCAGG + Intronic
1088776321 11:113087248-113087270 TTGCAATGACAGCTGGGGGCAGG + Intronic
1089174079 11:116535987-116536009 CAACACTGACAGCTTCTGGTGGG + Intergenic
1089221160 11:116873180-116873202 CACTCCTGCCAGCTTGGGGCAGG - Intronic
1089634632 11:119804325-119804347 CACCAGGGACAGCTTGGGGAGGG - Intergenic
1090078460 11:123594301-123594323 GAGCCCTGACAGCTGGGGCCAGG - Intronic
1091119007 11:133041364-133041386 CAGCAGTGACACCTTATGGCTGG + Intronic
1202822893 11_KI270721v1_random:76821-76843 GAGCACTGCCAGCGTGGGGGTGG - Intergenic
1093464502 12:19436381-19436403 CAGCACTGAGGGCTTCTGGCTGG - Intronic
1094491274 12:30962486-30962508 CAGCTCTGTGAGCATGGGGCAGG - Intronic
1095525406 12:43119123-43119145 GAGCACTGACATCTGAGGGCAGG + Intergenic
1098302350 12:69067155-69067177 CAGCCCTGCCAGCATGTGGCTGG + Intergenic
1102437468 12:112936494-112936516 CAACACAGAAAGGTTGGGGCGGG + Intergenic
1103471978 12:121189535-121189557 CATCCCTGCCAGCTTGGGACAGG - Intergenic
1103913710 12:124365376-124365398 CAGCACTGGCAGCTGGGGACTGG - Intronic
1104441435 12:128796696-128796718 CAGCAGTGACAGCTAGTGCCAGG - Intronic
1110789846 13:79575663-79575685 CAGCATGGACAGATTGGGGCAGG + Intergenic
1113088532 13:106593145-106593167 AAGCACAGAGAGCCTGGGGCAGG - Intergenic
1113091884 13:106625359-106625381 CATCACTGACTGCTTGGGTTGGG - Intergenic
1113707693 13:112445143-112445165 AAGCACCGACAGATTGGGACCGG + Intergenic
1113937143 13:114000450-114000472 CAGATCTGACAGCGAGGGGCAGG + Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116452989 14:45084731-45084753 CAGCACCCACAGCTTTTGGCAGG + Intronic
1118006998 14:61572281-61572303 AAACAAGGACAGCTTGGGGCTGG + Intronic
1118374499 14:65165009-65165031 CAGCACTGACAGCTGGGGACAGG - Intergenic
1119199514 14:72742334-72742356 AAGCACTGACAGATGGGGGTGGG + Intronic
1120860734 14:89253132-89253154 GAGCCCTGACAACCTGGGGCAGG - Intronic
1122023694 14:98859450-98859472 AAGCTCCCACAGCTTGGGGCTGG - Intergenic
1123006627 14:105326872-105326894 CAGGACTGACTGCAAGGGGCAGG - Intronic
1123457134 15:20436436-20436458 CAGCACAGAGAGCATGGGGTGGG + Intergenic
1123466681 15:20521951-20521973 GAGCCCTGGCAGCTTGGGTCAGG + Intergenic
1123660928 15:22563923-22563945 CAGCACAGAGAGCATGGGGTGGG - Intergenic
1123741850 15:23287951-23287973 GAGCCCTGGCAGCTTGGGTCAGG - Intergenic
1123745146 15:23314607-23314629 GAGCCCTGGCAGCTTGGGTCAGG + Intergenic
1123782256 15:23640034-23640056 CAGCCCCGGCAGCTAGGGGCAGG + Intergenic
1124263288 15:28211589-28211611 CAGCACAGAGAGCATGGGGTGGG + Intronic
1124267822 15:28253003-28253025 AAGCACTGGCAGGTTGGGTCAGG - Intronic
1124277418 15:28337927-28337949 GAGCCCTGGCAGCTTGGGTCAGG + Intergenic
1124305283 15:28573679-28573701 GAGCCCTGGCAGCTTGGGTCAGG - Intergenic
1124314729 15:28658157-28658179 CAGCACAGAGAGCATGGGGTGGG - Intergenic
1124501045 15:30226074-30226096 CAGCACTGGCACCGAGGGGCGGG + Intergenic
1124742524 15:32312593-32312615 CAGCACTGGCACCGAGGGGCGGG - Intergenic
1125599953 15:40910038-40910060 CCGCACTGAGAGCATGGGGAAGG - Intergenic
1126203322 15:46014642-46014664 CAGCAGTGACAGCAGTGGGCGGG + Intergenic
1126335625 15:47583662-47583684 CATCACTGACAGCTGGGGTATGG - Intronic
1126563293 15:50068278-50068300 TAGCACTGACTGCTGGGGGTTGG + Intronic
1126795188 15:52254558-52254580 CAGCACAGAAAGCTTTGGGTAGG - Intronic
1127670265 15:61188116-61188138 AAGCCCAGACAGCTTGGGGTTGG - Intronic
1127846415 15:62875170-62875192 CAGGACTGAGAGCTCAGGGCTGG - Intergenic
1127955166 15:63847057-63847079 CAGCATGGAGATCTTGGGGCTGG - Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129354467 15:74980397-74980419 CAACACTGACAGGCTGAGGCAGG - Intronic
1129479982 15:75816005-75816027 CAGCACTGCCAGCTTTGGGATGG - Intergenic
1130964910 15:88689971-88689993 GAGCAATGGCAGCTTGGGGATGG + Intergenic
1131627144 15:94133613-94133635 AAGAAGTGACAGCTTGGGTCGGG - Intergenic
1133130894 16:3675632-3675654 CTGCAATGTCAGCTTGTGGCTGG + Intronic
1133307382 16:4818975-4818997 CAACCCTGAGAGCTGGGGGCTGG + Intronic
1133447172 16:5871666-5871688 CAGCATAGACAACGTGGGGCTGG - Intergenic
1133810467 16:9157460-9157482 CAGAACTGTCAGTCTGGGGCTGG + Intergenic
1134097105 16:11425160-11425182 CGGCACGGACAGCTTGCGGGTGG - Exonic
1135251335 16:20902679-20902701 AAGCACTGACAGCTGGGAGAGGG - Exonic
1136028916 16:27488740-27488762 GTGCACTGACAGCCAGGGGCTGG + Intronic
1136078723 16:27837525-27837547 CATCACTGACACCATGGGGAGGG + Intronic
1136300410 16:29330242-29330264 AGGCACAGACAGGTTGGGGCTGG + Intergenic
1136597423 16:31261087-31261109 CAGCTCTGTTAGCCTGGGGCGGG - Intronic
1138196168 16:55053870-55053892 CAGAACTCCCAGCTGGGGGCTGG + Intergenic
1138652385 16:58468090-58468112 CAGCTCTGACATCATGGGGAAGG + Intronic
1138693818 16:58792765-58792787 CAGCACTGAGCTCCTGGGGCAGG - Intergenic
1139268389 16:65660378-65660400 CAGCACTGAAAGCCTGGGGAAGG - Intergenic
1139483254 16:67242388-67242410 CAGGACAGACAGCTGGGGGTGGG - Intronic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1141586995 16:85040687-85040709 AAGCAATGATAGCTTGGGGAGGG - Intronic
1141693933 16:85611332-85611354 CAGCCCTGGCCGCCTGGGGCCGG + Intergenic
1142957545 17:3531842-3531864 CAGCCCTGACCACTTGGGACAGG + Intronic
1143348767 17:6271260-6271282 CAGCACCTACAGCTGGGGCCAGG - Intergenic
1143771294 17:9170636-9170658 CAGCACAGAGAGGTGGGGGCGGG + Intronic
1144701673 17:17344636-17344658 CAGCACTGACTGCCTGGCGCTGG + Intronic
1145267566 17:21387769-21387791 CATCACTGACAGCTGAGGGTTGG - Intronic
1147440662 17:40445438-40445460 CAGGACAGGAAGCTTGGGGCTGG - Intronic
1147658727 17:42105641-42105663 CAGCACAGAGAGGTGGGGGCAGG - Intronic
1152134202 17:78494415-78494437 CAGCACTGACAGGGTGGGGCTGG + Intronic
1152800698 17:82329478-82329500 CAGCCCTGACAGGGTGGGGTGGG - Intronic
1153820687 18:8828952-8828974 AAGCACTTACAGCGTGAGGCGGG - Exonic
1155108515 18:22690571-22690593 CAGCAATGACAACTGGGGTCAGG - Intergenic
1155276141 18:24189452-24189474 CTCCACTGACAGCCGGGGGCTGG + Intronic
1156454077 18:37283051-37283073 CAGCACTGCCTCCTTGGGGGCGG - Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1161283371 19:3457195-3457217 CAGGACAGACAGGATGGGGCAGG + Intronic
1161477361 19:4494046-4494068 CAGCAGTGACAGGTGGGTGCTGG + Exonic
1161718706 19:5891853-5891875 CAGCCCTGACTGCCTGGGGCTGG + Exonic
1162507851 19:11097616-11097638 CAGCACTGAGAGGCTGAGGCAGG + Intronic
1162524478 19:11199435-11199457 CAGCACAGACAGCTGAGGCCCGG + Exonic
1163159452 19:15456257-15456279 CAGCACAGCCAGATAGGGGCTGG + Intronic
1163624632 19:18382144-18382166 CCGCACTGACACCTGGGGTCTGG - Intronic
1163725826 19:18922523-18922545 CAGCCCAGACAGCGTGGGGAGGG + Intronic
1164478765 19:28595335-28595357 CAGATCTTACAGCTTGGGGCTGG + Intergenic
1164951005 19:32336971-32336993 CAACAATGACATCTAGGGGCTGG - Intergenic
1164962183 19:32443097-32443119 CTGCACCGACAGCATGGGGTAGG - Intronic
1165152164 19:33767198-33767220 CAGCACTGACAGGTGAGGACAGG - Intronic
1166112402 19:40630670-40630692 CAGTCCTGACAGCTGGAGGCGGG + Intergenic
1166484090 19:43198164-43198186 CACCACTGGTAGCTTGCGGCTGG + Exonic
1166620629 19:44297138-44297160 CAGCACTGGCTGCTTGGCCCAGG - Intronic
1166650671 19:44572049-44572071 CCACACTGAGAGTTTGGGGCAGG + Intergenic
1168429207 19:56264240-56264262 CAACACTGGCAGGTTGAGGCAGG - Intronic
934119961 2:88829033-88829055 AAGCACTCACAGAATGGGGCTGG + Intergenic
934561938 2:95317996-95318018 CAGAAGGGACAGCTTTGGGCCGG + Intronic
936062487 2:109304510-109304532 CATCACTGACACCCTGGGGTTGG - Intronic
937222962 2:120352690-120352712 CAGCACAGCCAGCTGGTGGCAGG + Intergenic
941535652 2:166719670-166719692 CAGCATTCATAGCTTGGGCCGGG - Intergenic
941700819 2:168602816-168602838 CAGGACTGAGAGGCTGGGGCTGG - Intronic
942407505 2:175671198-175671220 CAGCACTGGGAGCCTGAGGCGGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
942799044 2:179855908-179855930 CAGATTTGAGAGCTTGGGGCAGG - Intronic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
948164572 2:235851213-235851235 CAGCACTGACAGCCTGGACAGGG - Intronic
1169344516 20:4819945-4819967 TTGCGGTGACAGCTTGGGGCTGG - Intronic
1169458930 20:5777679-5777701 CAACACTGAGAGGTTGAGGCGGG - Intronic
1170036018 20:11991038-11991060 CATCACTGACAGAATGGAGCAGG - Intergenic
1172482578 20:35279640-35279662 CACCACTGACAGCTCTGTGCTGG + Exonic
1172861031 20:38052045-38052067 TAGAAATGACAGCTAGGGGCCGG - Intronic
1173087616 20:39939309-39939331 CAGGAAGGACAGCTTGGGGGTGG - Intergenic
1173133942 20:40422682-40422704 CAGGACTGACACTTTGGTGCTGG - Intergenic
1173274468 20:41567330-41567352 CATCACTGGCCACTTGGGGCAGG + Intronic
1173469208 20:43309547-43309569 CAGCTCTCAGAGCTTGGGCCAGG - Intergenic
1174188925 20:48726178-48726200 CAGCAGTGTCAGCTTTGGGCCGG - Intronic
1174601914 20:51731837-51731859 CAGCTGTGACAGCATGGGGTGGG - Intronic
1174773531 20:53323144-53323166 CAGCACTGACATTTTAGAGCTGG - Intronic
1175899485 20:62354404-62354426 TAGCACTGACTGCTGGGGGCAGG - Intronic
1176022886 20:62971079-62971101 CAGCACAGACAGCCTCGGGCAGG + Intergenic
1178877299 21:36422961-36422983 CATCACTCACAGCTTGGGAGGGG + Intergenic
1179541472 21:42085804-42085826 CAGCACTCCCAGGTTGGTGCTGG - Intronic
1180588342 22:16914005-16914027 CAGCAGTCACAGCCTGGGGAAGG - Intergenic
1181166880 22:20988709-20988731 CTGCACTGACCACATGGGGCTGG + Intronic
1183284664 22:36954278-36954300 GGGCAGTAACAGCTTGGGGCAGG - Intergenic
1183411375 22:37656738-37656760 CAGCACTGGGAGCCTGAGGCAGG + Intronic
1183608843 22:38883892-38883914 CAGAACTGGCAGAATGGGGCTGG - Intergenic
1184035899 22:41917942-41917964 CAGCATTGGGAGCTGGGGGCGGG - Intergenic
1184404762 22:44293508-44293530 CACCACTGACATCTGGGGCCAGG - Intronic
1185322620 22:50208955-50208977 CTGCAGGGCCAGCTTGGGGCGGG + Intronic
950496710 3:13338188-13338210 CAGCACTGCAGACTTGGGGCCGG + Intronic
950808782 3:15632008-15632030 CAGCAAGGACAGCAGGGGGCTGG - Intronic
950890544 3:16400372-16400394 CAACACTGCCAGCCTGGGGCAGG + Intronic
951500411 3:23380470-23380492 CAGCACTGGCAGGTGGAGGCGGG - Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
954437969 3:50505908-50505930 CAGCACAGGCAACTTGGGCCAGG - Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
956302223 3:67784612-67784634 CATTACTGACTGCTGGGGGCAGG + Intergenic
961471308 3:127114866-127114888 CAGCAATGAGAGCCTGGGGAGGG + Intergenic
961491209 3:127257863-127257885 CTGCCCTGACAGCTGGAGGCTGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
966806953 3:183815295-183815317 CAGCACTGCCAGGAAGGGGCAGG + Intergenic
967568540 3:191000049-191000071 AAACACTGAGAGGTTGGGGCAGG + Intergenic
969505423 4:7583880-7583902 CAGCACAGAGAGCTTAGGTCTGG + Intronic
970276335 4:14405084-14405106 CAGCACTGCCAGCCTTGGGCAGG - Intergenic
971425503 4:26511207-26511229 CAACACTGAGAGCCTGAGGCAGG - Intergenic
972333672 4:38086421-38086443 CACTACTGACATTTTGGGGCTGG - Intronic
972657242 4:41076283-41076305 CAGCACTGAAAACTGGGGGATGG + Intronic
976241470 4:82961704-82961726 CAGCACTGACAGGCTGAAGCGGG + Intronic
978571716 4:110145210-110145232 CAGCCCTGTTAGCTAGGGGCTGG - Intronic
982278199 4:153658471-153658493 CGGCACCGACAGCTGGGGCCTGG + Intergenic
982321842 4:154085007-154085029 CAGAACTGACAGCCTGGGCCAGG - Intergenic
984375328 4:178922298-178922320 CAGAACTGACAACTTGGCCCTGG - Intergenic
985720433 5:1485994-1486016 CTGCTCTGAGAGCTTGGAGCTGG + Intronic
985750346 5:1670011-1670033 CAGCACTCTCAGCTTGAGGAAGG + Intergenic
985953054 5:3237869-3237891 CAGCACTCACAGCATGGGGCAGG + Intergenic
986957868 5:13177015-13177037 CAGCACTGCGAGCTTAGAGCAGG - Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
990988859 5:61665805-61665827 CCGAACTGACAGCTTGGGGGCGG + Intronic
993644051 5:90441091-90441113 CAGCACTGACAGCATTGGAGTGG - Intergenic
994054920 5:95404254-95404276 TAGCACTGACAGCATGGTGGGGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995275119 5:110268981-110269003 CAGCAATGGCAGCCTGGAGCTGG - Intergenic
999175718 5:149630463-149630485 CAGCACTCACAGCCTGCGGCAGG - Intronic
1001405920 5:171477526-171477548 CAGTTCTGACAGTTTGGGACAGG + Intergenic
1001583950 5:172820297-172820319 CAGCGCTGACGTCCTGGGGCAGG - Intergenic
1002159607 5:177307502-177307524 CAGCCCTGAAGGCTTGGGGAGGG + Exonic
1002705607 5:181159510-181159532 AAGCACAGACAGCATGGGGCAGG + Intergenic
1005430728 6:25754061-25754083 AAGCACTGACAGATGGGGCCTGG + Intergenic
1006115829 6:31775787-31775809 AAGCACTGCCAGCTTGGAGGTGG + Intronic
1007706719 6:43795597-43795619 CACCACTGGCATCTGGGGGCCGG - Intergenic
1010177908 6:73051191-73051213 CAGCAGTGGCAGCGTGGGGCAGG - Intronic
1010959961 6:82134612-82134634 CACCACTGACTGCTTTGGCCAGG + Intergenic
1011812617 6:91150575-91150597 CAGCACTCACAGCCTGGCCCTGG - Intergenic
1013915902 6:115336560-115336582 TTGCACTGACAGCATGTGGCTGG + Intergenic
1014104681 6:117548289-117548311 GGGCGCTGACAGCTTTGGGCCGG - Intronic
1015159332 6:130134836-130134858 CAACACTGACAACTGGTGGCTGG - Intronic
1015185601 6:130412353-130412375 CAGCACTGACAGTGAGAGGCAGG - Intronic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1015837251 6:137433764-137433786 CAGCACTGACAGACTGGAGGGGG - Intergenic
1018028848 6:159826341-159826363 CACCACTGAGGGCCTGGGGCTGG + Intergenic
1018441303 6:163815962-163815984 CAGCACAGAGAGCCTGGGGAAGG - Intergenic
1019275431 7:173207-173229 CGGCACTGGCAGCGCGGGGCGGG - Intergenic
1019574766 7:1732055-1732077 CTGCACCGAAAGCTCGGGGCAGG - Intronic
1019648125 7:2141794-2141816 CCGCACAGACAGCCTGGGGAAGG + Intronic
1019761771 7:2818236-2818258 CAGTACTGACATCTGGGGGCTGG + Intronic
1021046942 7:15934506-15934528 CAGCATTTCCAGTTTGGGGCAGG + Intergenic
1021891966 7:25194887-25194909 CAACAGTGCCAGCTTGGGGCAGG + Intergenic
1022926116 7:35057716-35057738 CAGCTGTGACAGCTGGTGGCGGG - Intergenic
1023937448 7:44749522-44749544 CAAAACTGGCAGCTGGGGGCTGG - Intronic
1024109723 7:46133115-46133137 CAGCAGGGACAGCCTAGGGCAGG - Intergenic
1024359107 7:48449137-48449159 CAGTACAGACAGCTAGGAGCCGG - Intronic
1026983902 7:74542810-74542832 CAGCACTCACAGCCAGAGGCTGG + Intronic
1029196621 7:98810061-98810083 CAGCAGTGACTGCTCAGGGCTGG + Intergenic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030212060 7:107006350-107006372 CAGAAATCACAGCTGGGGGCGGG - Intergenic
1030809240 7:113955336-113955358 AGGCAGTGTCAGCTTGGGGCAGG + Intronic
1031641964 7:124175693-124175715 CAGCACAGCCAGCTAGGGACAGG - Intergenic
1034222301 7:149455836-149455858 GAGCACTGGAAGTTTGGGGCAGG + Exonic
1034257294 7:149731640-149731662 GAGCACAGAGACCTTGGGGCAGG - Intronic
1035583213 8:753154-753176 CAGACCTGACCGCTTAGGGCCGG + Intergenic
1035750724 8:1994258-1994280 CAGCACTGGGATCCTGGGGCAGG - Intronic
1037541454 8:19875851-19875873 CTGCACTGTCATCTCGGGGCTGG + Intergenic
1037588636 8:20295131-20295153 CAGCAGTGACAGCGTCAGGCAGG - Intronic
1038293621 8:26271430-26271452 CAGCACTGGGAGGTTGAGGCAGG - Intergenic
1038335659 8:26643461-26643483 CATCACTGCCAGCTTGGGAACGG + Exonic
1039817617 8:41108589-41108611 CAGAAATGACAGCCAGGGGCTGG - Intergenic
1043483456 8:80675874-80675896 GAGCACTGAAAGCTTGGGTGTGG + Intronic
1044229581 8:89758319-89758341 TGGCAGTGACCGCTTGGGGCCGG + Intronic
1047409984 8:124616475-124616497 CAGCACTGACATATGGGGGTTGG - Intronic
1048052914 8:130836366-130836388 CAGCACTGCCAGCTTCAGGACGG + Exonic
1048317652 8:133374285-133374307 CAGCTCTGACTGCTTTGAGCTGG + Intergenic
1049404790 8:142447539-142447561 CAGCCCTGAGAACCTGGGGCTGG + Intergenic
1049601547 8:143510013-143510035 CAGGAGGGGCAGCTTGGGGCAGG + Intronic
1049675744 8:143888136-143888158 TAGCACTGACAGGGTGGGGGCGG + Intergenic
1049754977 8:144307024-144307046 CAGAAGTGAGAGCTCGGGGCTGG + Intronic
1050409926 9:5353085-5353107 CTGAACTGACAGCTTAGGACAGG - Intergenic
1057277075 9:93681665-93681687 CATGACTGACAACCTGGGGCAGG + Intergenic
1057556876 9:96095182-96095204 CAGGACTGGCAGCGTGGGTCAGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1061571974 9:131483470-131483492 CTCCACTCACTGCTTGGGGCTGG + Intronic
1061825527 9:133256212-133256234 CAGCACTGACAGCTGCCGACCGG + Exonic
1061941377 9:133886027-133886049 CCGTACTGACAGCTGGGGGGCGG + Intronic
1061992566 9:134167551-134167573 CAGCACTGAGAGCTGGGGGCCGG - Intergenic
1062284965 9:135768750-135768772 CGGCACCGGCAGCCTGGGGCAGG - Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1187270675 X:17776630-17776652 CAGCCCTGAGTGCTTTGGGCAGG - Intergenic
1189331091 X:40145566-40145588 CAGCACGGAGAGTTTGGGGCGGG - Intronic
1190274709 X:48892322-48892344 CAGAAGTCACAGCTTGGGGGCGG + Intergenic
1190305575 X:49079812-49079834 CGGCACCGACAGCTGGGGCCCGG - Exonic
1192247263 X:69384114-69384136 CAGCACTCACAGCTGGGAGATGG - Intergenic
1193031829 X:76907078-76907100 CTGCACTGAGAGGGTGGGGCAGG - Intergenic
1197132668 X:123022559-123022581 CTCCACTGACAGCATGAGGCAGG + Intergenic
1198119976 X:133582861-133582883 CAGCACTAACTGCTTGTAGCCGG + Intronic
1198497514 X:137207195-137207217 CAGCACTGATAGGTTGGAACTGG - Intergenic
1198616402 X:138463102-138463124 CAGCACTGAGAGCTTGCCCCAGG - Intergenic
1198936089 X:141903797-141903819 CAGCCCGGATAGCGTGGGGCGGG - Intergenic
1199336835 X:146628400-146628422 GAGCAATGACTGTTTGGGGCCGG + Intergenic
1199350179 X:146790829-146790851 CAGCAGTGACAGTTGTGGGCTGG - Intergenic
1202153193 Y:21861361-21861383 CAGAGCTGACAGCTTAGGCCTGG + Intergenic