ID: 1068046459

View in Genome Browser
Species Human (GRCh38)
Location 10:51892488-51892510
Sequence TGCCCAGGACACTCCTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068046459_1068046462 -4 Left 1068046459 10:51892488-51892510 CCATCATAGGAGTGTCCTGGGCA 0: 1
1: 1
2: 0
3: 10
4: 125
Right 1068046462 10:51892507-51892529 GGCAACAGGTGTCCAGCCTTTGG No data
1068046459_1068046463 -3 Left 1068046459 10:51892488-51892510 CCATCATAGGAGTGTCCTGGGCA 0: 1
1: 1
2: 0
3: 10
4: 125
Right 1068046463 10:51892508-51892530 GCAACAGGTGTCCAGCCTTTGGG No data
1068046459_1068046464 7 Left 1068046459 10:51892488-51892510 CCATCATAGGAGTGTCCTGGGCA 0: 1
1: 1
2: 0
3: 10
4: 125
Right 1068046464 10:51892518-51892540 TCCAGCCTTTGGGAGATGAGAGG No data
1068046459_1068046467 30 Left 1068046459 10:51892488-51892510 CCATCATAGGAGTGTCCTGGGCA 0: 1
1: 1
2: 0
3: 10
4: 125
Right 1068046467 10:51892541-51892563 TTGAGCAAGACTCAGTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068046459 Original CRISPR TGCCCAGGACACTCCTATGA TGG (reversed) Intronic
900596391 1:3482009-3482031 TGCCCAGGACAGTCCTGCGTGGG - Intergenic
902836418 1:19049838-19049860 TGCACATGACACTTCTATGGAGG + Intergenic
910113786 1:83710536-83710558 TTCTCATGACAATCCTATGATGG + Intergenic
910388074 1:86705472-86705494 AGCCCAGGACAGTCCTTTCAGGG - Intronic
913257457 1:116966561-116966583 GGCAGAGGACACTCCTATAAAGG - Intronic
913448767 1:118977674-118977696 TGCCCAGCATACACCTAGGAGGG - Intronic
914863758 1:151408227-151408249 GGCCCATGACACTCCTGTGGGGG + Exonic
915145187 1:153792687-153792709 TGTCCCGGAGCCTCCTATGAGGG - Intergenic
918041864 1:180918484-180918506 GGCTCAGGACACTGCCATGAAGG - Intronic
1067708168 10:48626675-48626697 TCCCCAGGACACTCATGTGGAGG + Intronic
1068046459 10:51892488-51892510 TGCCCAGGACACTCCTATGATGG - Intronic
1068733898 10:60390369-60390391 TCCCCAGGACTCTCCTCTCATGG + Intronic
1071509383 10:86251580-86251602 TCCCCAGGCCACTCCTGTCAGGG - Intronic
1073175857 10:101557061-101557083 TGGCCAGTGCACTCCAATGATGG + Exonic
1075725146 10:124607155-124607177 TGCCGAGGACACACCTTTGCTGG + Intronic
1076386907 10:130063638-130063660 TGCCGAGGACACTCCCTGGAGGG + Intergenic
1076562730 10:131377575-131377597 TGCCCAGGCCTCTCCCTTGAAGG + Intergenic
1076815514 10:132912924-132912946 TGCCCACGACCCTCCTCTGCTGG + Intronic
1078171706 11:8933251-8933273 ATCCCAGGAGACTCCTGTGAGGG + Intergenic
1078656520 11:13245641-13245663 GGAGCAGGACACTCCTCTGAGGG + Intergenic
1079363817 11:19792008-19792030 TGCCCAGGACAGTCCTCTCATGG - Intronic
1079946068 11:26742461-26742483 TGAACAGGAAAATCCTATGAGGG - Intergenic
1081751887 11:45517306-45517328 CGCCCAGGCCAGTCCTATGCTGG + Intergenic
1084360250 11:68664536-68664558 CGGCCTGGTCACTCCTATGATGG + Intergenic
1086044959 11:82521841-82521863 TGCTCAGGAAAATCCTCTGAGGG + Intergenic
1087813214 11:102630950-102630972 TGCCCAGCACACTCCTCTCCAGG - Intergenic
1088827057 11:113504787-113504809 TTACCAGGACACTCTTGTGATGG - Intergenic
1089535850 11:119160490-119160512 TGTCCTGGTCACCCCTATGATGG + Intronic
1089653867 11:119933034-119933056 TGCCTAGGACACCCCCGTGATGG + Intergenic
1093490790 12:19701520-19701542 TGGCCACAACACTCCAATGAAGG - Intronic
1094163086 12:27412418-27412440 TGCCCAGGGAACTAATATGAAGG + Intronic
1104660534 12:130608652-130608674 TGCCCAGGCCACTCCTCTTTAGG + Intronic
1105230885 13:18494555-18494577 TTTCCAGAACACTGCTATGAGGG - Intergenic
1105623995 13:22095518-22095540 TGCCCAGGACTGTCCAATGTTGG + Intergenic
1107079723 13:36361988-36362010 TGCCTAGGACACTCCATTGTAGG + Intronic
1107741109 13:43451392-43451414 TACACAGGGCACTCCTCTGATGG + Intronic
1112552385 13:100433797-100433819 TGCCATGGACACCCTTATGATGG - Intronic
1113373088 13:109740349-109740371 TGACCAGGAAACACCTGTGATGG + Intergenic
1113617554 13:111691732-111691754 TGCCCATGACAGTGCTTTGAAGG + Intergenic
1113623084 13:111776992-111777014 TGCCCATGACAGTGCTTTGAAGG + Intergenic
1113775857 13:112944206-112944228 AGCCCAGGACCCTCCTCTCACGG - Intronic
1114022196 14:18490346-18490368 TTTCCAGAACACTGCTATGAGGG + Intergenic
1114022499 14:18493167-18493189 ATCCCAGAACACTGCTATGAGGG + Intergenic
1114024626 14:18513769-18513791 ATCCCAGGACACTGCTACGAGGG + Intergenic
1115082482 14:29473573-29473595 TGCCCAGGAAACACCTAAAAAGG - Intergenic
1115093958 14:29612469-29612491 TCCCCAAAACACTCCTATGAAGG + Intronic
1116815922 14:49583636-49583658 TGCCCCGGATAATCCTCTGAAGG + Intronic
1121757384 14:96414427-96414449 TGGCCAGGAGACTCCCAGGAAGG + Intronic
1122949020 14:105030474-105030496 TGCTCAGGACACTCCTGTCAAGG + Intergenic
1128728078 15:70002503-70002525 GGGCCAGGTCACTCCTCTGATGG + Intergenic
1129926220 15:79366624-79366646 TGCCCAGCAGGCTCCTAAGAGGG + Intronic
1131890227 15:96964610-96964632 TGCCCAGGACACTGCCAGGCAGG - Intergenic
1138097809 16:54226157-54226179 TGCCCAGGACGCTCTACTGATGG - Intergenic
1139711830 16:68781979-68782001 AGCCCAGGAAACTCCTTTCATGG + Intronic
1142218911 16:88843372-88843394 TGCCCTGGACGCTCGTATGCAGG - Intronic
1145001699 17:19309811-19309833 TGCCCAGGAAACTGCTGTGCAGG + Intronic
1145917540 17:28584382-28584404 TGCCCAGGACCTGGCTATGAAGG - Exonic
1147623050 17:41880961-41880983 TGATCAGGACACTTCTAAGAGGG - Intronic
1152198314 17:78930347-78930369 TGCCCTGGACACTCCCCTGAGGG - Intergenic
1152623856 17:81379531-81379553 TGGCCAGGAGACTCCCAGGAAGG + Intergenic
1156025903 18:32655096-32655118 GACCCAGGACAGTCCTAGGATGG - Intergenic
1157222092 18:45835832-45835854 GGCTCAGGACACTACAATGAAGG + Intronic
1157306522 18:46521393-46521415 GGCCCAGGTCCCTCCCATGAAGG + Intronic
1157385331 18:47255202-47255224 TGCCAGGGACACTTCTATCAGGG - Intergenic
1161406420 19:4093923-4093945 TGCCCGGGGCCCTCCTCTGAGGG + Intronic
1163403901 19:17110806-17110828 TGCCCAGGACATTCCAGTGAGGG + Intronic
1166203734 19:41255260-41255282 TCCACAGGACATTCATATGATGG - Intronic
1167610987 19:50507653-50507675 TGCCCAGGAGGCTGCGATGAGGG + Exonic
1167900970 19:52622049-52622071 TCCCCAGGCCACTCCTCAGAAGG + Intronic
925593951 2:5536909-5536931 TGCCCAGGTCACTTCTATCAGGG - Intergenic
932736557 2:74258801-74258823 TGCCCGGGACACTGACATGAGGG + Intronic
933305194 2:80588748-80588770 TGCCCAGGGCACTCCAGGGACGG - Intronic
937983910 2:127630054-127630076 TCCCCCGGACACCCCCATGATGG - Intronic
943570079 2:189564016-189564038 AGCCCAGGACAGTCATATAAAGG + Exonic
944599449 2:201288582-201288604 GGCCCAGGAAACTCCTGGGAGGG - Exonic
947930428 2:233960267-233960289 TGCCCAGGAACCTTCTATTATGG - Intronic
948981089 2:241495231-241495253 CGGCCAGGACACTCCTCTGGGGG + Exonic
1170466961 20:16630966-16630988 TGCCCAGAAGACTCCTGTAATGG + Intergenic
1174939801 20:54913809-54913831 TGCCCAAGACAATCATATTATGG - Intergenic
1176774874 21:13122908-13122930 TTTCCAGAACACTGCTATGAGGG - Intergenic
1180150449 21:45944476-45944498 GGCCCTGGACTCTCCTGTGATGG + Intergenic
1180446542 22:15419581-15419603 ATCCCAGAACACTGCTATGAGGG + Intergenic
1180448735 22:15440770-15440792 ATCCCAGGACACTGCTACGAGGG + Intergenic
1180448786 22:15441250-15441272 ATCCCAGGACACTGCTACGAGGG + Intergenic
1181426703 22:22848602-22848624 TGCCCAGGAGGAGCCTATGAAGG + Intronic
950098329 3:10342950-10342972 TCCCCAGGACTCCCCTCTGAAGG - Exonic
952696353 3:36268968-36268990 TGCCCAGTTCACTCCTAGGATGG + Intergenic
954138394 3:48592810-48592832 GGTCCAGTACACTCCTCTGACGG - Exonic
954256878 3:49413150-49413172 TTCCAAGGACACTCCTGTGCTGG + Intronic
954521840 3:51234803-51234825 TGCCCAGAAAAGCCCTATGAAGG - Intronic
957092969 3:75750277-75750299 ATCCCAGAACACTGCTATGAGGG + Intronic
962028696 3:131575685-131575707 TTCTCAGAACAATCCTATGAAGG + Intronic
962355785 3:134693269-134693291 TGCCTAGAACTCACCTATGATGG + Intronic
964448921 3:156791207-156791229 TGCCCAGCAGACTCTTAAGAGGG - Intergenic
970060781 4:12031524-12031546 TGCCCAGTACTCTCCTCTGCAGG - Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
977785858 4:101034206-101034228 TACCCAGCACACTCCACTGAGGG + Intronic
980886915 4:138772798-138772820 TTCCCAGGACACTTCTATGTTGG - Intergenic
984459252 4:180012105-180012127 TGCACAGAACACTGCTATGGAGG - Intergenic
990358227 5:54991675-54991697 TTCCCAGGACACTCTCATGCAGG - Intronic
993108668 5:83628935-83628957 TGCAAAGGAAACTCCTATAAAGG + Intergenic
993703379 5:91143811-91143833 TGCCCAGGCCATTCATATGGAGG + Intronic
996265586 5:121535395-121535417 TGACCACAACACTCCAATGAGGG - Intergenic
1001265864 5:170274251-170274273 TGCCCTGGACACTGCTGTAAAGG + Intronic
1001949932 5:175809167-175809189 TGCCAAGAACAGTCCTAAGATGG + Intronic
1002318274 5:178359757-178359779 GGCCCAGGCCACTTCTTTGAAGG + Intronic
1007789421 6:44300676-44300698 TGCCCAGGCCTCTGCTGTGAAGG + Exonic
1013828476 6:114243870-114243892 TCCCCAATACACTCCTAGGAGGG + Intronic
1017757341 6:157540478-157540500 TGGCCAGAACCCTCCTGTGAGGG - Intronic
1022825265 7:34004870-34004892 TGCCCAAGAAACACCTAAGAAGG - Intronic
1022973423 7:35537063-35537085 TGCCCATGTCACTCCGATAAGGG + Intergenic
1023055177 7:36285097-36285119 TCCCCAGGAGACTCTAATGAGGG - Intronic
1023840584 7:44095408-44095430 TGCCCAGGACTCTCATGTCAGGG + Intergenic
1024874015 7:54000293-54000315 TGTCCAAGACAGTCATATGAAGG - Intergenic
1026865707 7:73822809-73822831 TGACCAGGAGACTCCTAGGTCGG - Intronic
1030523261 7:110624200-110624222 TTCTCAGAACAATCCTATGAGGG + Intergenic
1034991534 7:155550770-155550792 TGCCCCCCACACTCCTTTGAGGG + Intergenic
1037638256 8:20719839-20719861 TGCCCAGGACTCTCCCCAGATGG + Intergenic
1040615865 8:49037752-49037774 TGGCCAGGAAACTCCAATGCTGG - Intergenic
1045577116 8:103435647-103435669 TGCACTGGACACTCCTGTAATGG + Exonic
1047299492 8:123600817-123600839 TGCCCAGGATACACCTAGAATGG + Intergenic
1048257425 8:132915570-132915592 TGCCCAGGACACACCTGGGCTGG + Intronic
1048503882 8:135003392-135003414 TTCCCAGGACACTCCTATGAGGG - Intergenic
1052990971 9:34519263-34519285 TGCCCAGGGAGCTCCCATGATGG + Intronic
1055559056 9:77504394-77504416 CACCCAGGACACTCTTCTGAAGG + Intronic
1057356805 9:94338881-94338903 TGCCGAGGAGACTCCGATGTTGG - Intergenic
1057724030 9:97555744-97555766 TGACCAAAACAATCCTATGAAGG + Intronic
1059705378 9:116818234-116818256 TACCCAGAACACTCTTAGGAAGG + Intronic
1203455711 Un_GL000219v1:165563-165585 ATTCCAGAACACTCCTATGAGGG - Intergenic
1203456224 Un_GL000219v1:170256-170278 ATTCCAGAACACTCCTATGAGGG - Intergenic
1185451690 X:284169-284191 TGCCCAGGGCTCACCTCTGATGG + Exonic
1187392488 X:18895285-18895307 TGCCCTGGAAACCCATATGAGGG + Intronic
1188262720 X:28038321-28038343 TCCCCAGGGCACTCCAAAGATGG + Intergenic
1188481018 X:30637003-30637025 TGCCCAGTTCTCTCCTATTAGGG + Intergenic
1199643630 X:149884822-149884844 TGCCTGGGCCTCTCCTATGATGG + Exonic
1199714644 X:150497982-150498004 TCCTCAGGACAATCCTATGAAGG - Intronic
1200018547 X:153182909-153182931 TGCCTAGGTCTCTCCTATGATGG + Exonic