ID: 1068047993

View in Genome Browser
Species Human (GRCh38)
Location 10:51912160-51912182
Sequence CAGACACACCATTTTAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068047992_1068047993 3 Left 1068047992 10:51912134-51912156 CCATGTGCATCTGGTGGAAGGAA 0: 1
1: 0
2: 1
3: 23
4: 302
Right 1068047993 10:51912160-51912182 CAGACACACCATTTTAAAGTAGG No data
1068047985_1068047993 30 Left 1068047985 10:51912107-51912129 CCAAGATCTAAATGAACGTATGG 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1068047993 10:51912160-51912182 CAGACACACCATTTTAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068047993 Original CRISPR CAGACACACCATTTTAAAGT AGG Intronic
No off target data available for this crispr