ID: 1068048558

View in Genome Browser
Species Human (GRCh38)
Location 10:51918896-51918918
Sequence CTCACGGGCTTGTACACAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068048553_1068048558 10 Left 1068048553 10:51918863-51918885 CCGAGACATATTTGTAGCTGCCA 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1068048558 10:51918896-51918918 CTCACGGGCTTGTACACAGTTGG No data
1068048556_1068048558 -10 Left 1068048556 10:51918883-51918905 CCAGAAAACCTAGCTCACGGGCT 0: 1
1: 0
2: 2
3: 6
4: 59
Right 1068048558 10:51918896-51918918 CTCACGGGCTTGTACACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068048558 Original CRISPR CTCACGGGCTTGTACACAGT TGG Intronic
No off target data available for this crispr