ID: 1068048886

View in Genome Browser
Species Human (GRCh38)
Location 10:51923674-51923696
Sequence GAATGACAGCAACCTTATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 18, 3: 46, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068048886 Original CRISPR GAATGACAGCAACCTTATAA GGG (reversed) Intronic
903579838 1:24362511-24362533 CAATGACACTAACTTTATAAAGG + Intronic
904870625 1:33615585-33615607 TAGTGACAGCACCCTTCTAATGG + Intronic
904967095 1:34383309-34383331 GAATTACAACAATGTTATAAGGG + Intergenic
906017926 1:42599244-42599266 TAATGACAGCAATGATATAAGGG + Intronic
907224990 1:52937526-52937548 GAATTACAGAAACCTTTTTAAGG - Intronic
908005862 1:59728337-59728359 AAATTACAGCAATGTTATAATGG - Intronic
908603749 1:65770632-65770654 GAATGACAGAAAGGATATAAAGG - Intergenic
909481304 1:76130986-76131008 AAAAGACAGCAACCTTCAAATGG - Intronic
909883418 1:80909532-80909554 GAATGACAGCAAAGTTATAAAGG + Intergenic
911632737 1:100200630-100200652 GAATGACAGACACCTCATACAGG + Intronic
912673983 1:111659907-111659929 GAATGACAGCAATGTTATAAGGG - Intronic
918092814 1:181312013-181312035 GAAAGACAACCACCCTATAATGG - Intergenic
918510489 1:185308069-185308091 GAAAGACAGCAACTATATAAGGG + Intronic
918950952 1:191136674-191136696 GAATGACAGCAATGATACAAAGG + Intergenic
920795961 1:209136649-209136671 GAATGACAGCAATGTTAGAAAGG + Intergenic
922181599 1:223239673-223239695 GAATGACAGCAATGGTACAAGGG - Intronic
923834428 1:237594321-237594343 GAAGAAAAGCAACGTTATAAAGG - Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1063471236 10:6287713-6287735 TAATGACAGCAATCATATAACGG - Intergenic
1064159861 10:12935921-12935943 GAATCACAGCAATGATATAAGGG - Intronic
1064774582 10:18761712-18761734 TAATGACAGAAAAGTTATAATGG + Intergenic
1066042909 10:31568878-31568900 GAATGACAGCAATTATACAAGGG + Intergenic
1066511321 10:36100026-36100048 GAATTACAGCAATGATATAAGGG + Intergenic
1067092888 10:43279168-43279190 GAATGACAGCAATGATACAAGGG + Intergenic
1067463190 10:46473624-46473646 GAATGATTACAACTTTATAAAGG + Intergenic
1067624003 10:47911014-47911036 GAATGATTACAACTTTATAAAGG - Intergenic
1067907052 10:50303312-50303334 GAATGACATCAATGTTCTAAGGG + Intergenic
1068048886 10:51923674-51923696 GAATGACAGCAACCTTATAAGGG - Intronic
1068761264 10:60712325-60712347 GAATGACAGCAATATTATAAGGG + Intronic
1070444691 10:76485442-76485464 GAATGACAGCAATTTCATAGAGG - Intronic
1070463687 10:76696254-76696276 GAATGACAACCATGTTATAAGGG - Intergenic
1070763518 10:79042417-79042439 GAAAGACAGCAATGTTACAAGGG + Intergenic
1071174796 10:82913267-82913289 GAATGACAGCAATGTTATAAGGG - Intronic
1072184245 10:93019709-93019731 CAAGGTCAGGAACCTTATAAGGG - Intronic
1072609510 10:97007782-97007804 GAACTACATCAACCTGATAAAGG + Intronic
1072942364 10:99777804-99777826 GAATGACAGCAAAGACATAAGGG - Intergenic
1073762727 10:106648244-106648266 GAATTACAGTAACTTTAAAAGGG - Intronic
1074868862 10:117561558-117561580 GCATGCCAGAAACCTTAGAAAGG - Intergenic
1080206671 11:29737231-29737253 GAAAGACAGGAACATTATAAAGG - Intergenic
1080286728 11:30623525-30623547 GAATGAAAGCAATGGTATAAGGG - Intergenic
1080654047 11:34244734-34244756 GGATTACAACAATCTTATAAGGG - Intronic
1081025772 11:38012889-38012911 GAATGAAAGCAATGTTATAAAGG - Intergenic
1081592230 11:44432070-44432092 GAATAACAGTAACTTTACAATGG - Intergenic
1084404282 11:68962026-68962048 TAATCACAGCGTCCTTATAAGGG + Intergenic
1086392477 11:86379546-86379568 GAATGACAGCAATGATACAAGGG - Intronic
1086532289 11:87800601-87800623 GATCGACAGAAACCTCATAAAGG - Intergenic
1086722848 11:90143013-90143035 ATATGACAGCTACTTTATAAAGG - Intronic
1088032971 11:105274924-105274946 GAAGGACAACAATCTTATTAAGG + Intergenic
1088112295 11:106276815-106276837 AAATGACAGCAACTTGAAAAAGG - Intergenic
1088164377 11:106915315-106915337 GAATGGCAGCAACCTTATAGGGG + Intronic
1088336659 11:108712594-108712616 GAATGACATCAATGATATAAGGG - Intronic
1089465641 11:118683885-118683907 GAATGACAGCAATGATAGAAGGG - Intergenic
1090159205 11:124474097-124474119 TAATGACAGCAATGTTATAAGGG - Intergenic
1091125855 11:133096173-133096195 GAATGATAGCAACAATACAATGG + Intronic
1092697367 12:11188171-11188193 GTATGACAGCAACATTAAAAAGG - Intergenic
1092834999 12:12478949-12478971 TAATGACACCCACCTGATAAAGG - Intronic
1093200183 12:16177190-16177212 AAACGACAGCAACCCTATAAAGG + Intergenic
1094314969 12:29129522-29129544 AAATGACAGCAAAGATATAAGGG - Intergenic
1094483347 12:30903017-30903039 GAGTGACAGTAACTTTATCATGG - Intergenic
1095231423 12:39744515-39744537 GAATGACAGCAGTGATATAAGGG + Intronic
1097816782 12:64083054-64083076 GAAAGCCAGCAGGCTTATAATGG - Intronic
1098595395 12:72269040-72269062 CACTGAAAGCAACCTTAAAAAGG + Intronic
1099160349 12:79233619-79233641 GAATGACAGCAGCTGTAGAAAGG - Intronic
1099546959 12:83995501-83995523 GAATAACAACAATGTTATAAGGG + Intergenic
1100606484 12:96156029-96156051 GAATTAATGCAACCTTAAAATGG + Intergenic
1104362599 12:128148209-128148231 GAATAACAGCAAACACATAACGG - Intergenic
1106306239 13:28513291-28513313 GAATGACAGCAATGATACAAGGG - Intergenic
1107239770 13:38218504-38218526 GAATGACACCAATTTAATAAAGG - Intergenic
1109654478 13:65371423-65371445 GAATGTCTCCAAACTTATAAAGG - Intergenic
1110332599 13:74289866-74289888 AAAGGACAGCCACCTTATATCGG + Intergenic
1110396126 13:75031142-75031164 GAATGACACCAATGTTCTAAGGG - Intergenic
1111974187 13:94948315-94948337 GGCTGACAGTAACCATATAACGG + Intergenic
1112210341 13:97370688-97370710 GAAAGAAAGAAACCATATAATGG + Intronic
1112270051 13:97960079-97960101 AAATGAAAGGGACCTTATAATGG - Intronic
1115668697 14:35584185-35584207 GAATGACAGCAATGATACAAGGG + Intronic
1116549506 14:46217946-46217968 GAAAGACAAAAACCATATAAAGG + Intergenic
1118018735 14:61689026-61689048 GAATGACAGCAATGTTAAAAGGG - Intergenic
1119534033 14:75385689-75385711 GAATGACAGCAATGTTATAAGGG + Intergenic
1120630374 14:86882850-86882872 GAAAGAAAGCAACCTTAAAGCGG - Intergenic
1121831250 14:97054230-97054252 GAATTCCAGCTACTTTATAAAGG + Intergenic
1121855934 14:97270313-97270335 TCCTGACAGCAACCTTATACAGG - Intergenic
1122102185 14:99421498-99421520 GAATGTCAGTTACCTTATAAAGG - Intronic
1202842797 14_GL000009v2_random:138554-138576 CAAGGACAGCAACTTTGTAAAGG + Intergenic
1202912194 14_GL000194v1_random:128796-128818 CAAGGACAGCAACTTTGTAAAGG + Intergenic
1123887181 15:24738123-24738145 GAATGACAGAAATAATATAAAGG + Intergenic
1124111819 15:26797143-26797165 GAATGACAGCAGTGTCATAAGGG - Intronic
1125627369 15:41119646-41119668 GAAAGACAGTAACTTTATAGTGG + Intergenic
1126499320 15:49327187-49327209 GGATGACAACAACTATATAAAGG - Intronic
1128590551 15:68892621-68892643 GAATGACAGAAATGTTAAAAAGG - Intronic
1131002712 15:88951419-88951441 GACTGAAAGCAAGTTTATAAAGG - Intergenic
1131391976 15:92057138-92057160 GAATGACAGAAAGCTAAGAATGG - Intronic
1133124094 16:3633756-3633778 TAATGACAGCAATATCATAAGGG - Intronic
1133978024 16:10614045-10614067 GAATGGCAGCAACATTATAAAGG + Intergenic
1140256772 16:73344108-73344130 GAAAAATAGCAACCTTATAATGG + Intergenic
1140617693 16:76686780-76686802 GAATGACAGCAATGATACAAAGG + Intergenic
1140624884 16:76781148-76781170 GAATGACAACAACGTTAAAGGGG - Intergenic
1140629549 16:76834883-76834905 CAATGACTGCCACCTTATAGGGG + Intergenic
1144115729 17:12088268-12088290 TAATGACAGTAACCTTAAGAGGG + Intronic
1145033494 17:19523533-19523555 GAATGACAGCAACCATAGAAAGG - Intronic
1145048230 17:19636369-19636391 GAATGACAACAGTGTTATAAGGG + Intergenic
1145228788 17:21154800-21154822 GAATGACAGCAACAGTGTAAGGG + Intronic
1148592198 17:48824819-48824841 GAGTGAGAGCAAGTTTATAAGGG + Intergenic
1151256861 17:72884171-72884193 GAAAGAAAGAAACCTTATAAAGG + Intronic
1155689413 18:28600140-28600162 GAATGACAGCACTGTTATAAGGG + Intergenic
1156066056 18:33144395-33144417 AAATGTCAGCAACATTATAATGG + Intronic
1157049060 18:44138951-44138973 GAATGAAAGCAATGTTACAAGGG + Intergenic
1157728679 18:49985342-49985364 GGATGACAGCAAACATGTAAGGG - Intronic
1157753483 18:50197913-50197935 GCCTCAGAGCAACCTTATAAAGG + Intergenic
1158755366 18:60317921-60317943 AAATGATAGCAATGTTATAAGGG - Intergenic
1164790752 19:30978244-30978266 GAATGACAGTAATGTTGTAAGGG - Intergenic
1165181133 19:33971567-33971589 GTATGACAACAACATCATAAAGG - Intergenic
1165602222 19:37064425-37064447 GAATGATAGGAACCTGTTAAAGG - Intronic
1165729904 19:38138540-38138562 GAATGACAGCAAACATGGAAAGG - Intronic
925784373 2:7416172-7416194 GAATGACAGCAATGATAAAATGG - Intergenic
926687954 2:15712536-15712558 GTATGACAGCATACATATAATGG - Intronic
927124509 2:20001623-20001645 GAAAGACAGTAACTTTATAGTGG - Intronic
928491363 2:31786851-31786873 GAATGACAGCAATGATACAAGGG + Intergenic
929072221 2:38043797-38043819 GAATGACAGCAATGTTAAAAAGG - Intronic
931205111 2:60139442-60139464 GAGTGACAGGGACCTTATCATGG - Intergenic
933161685 2:79031204-79031226 GAATGACAGCAATGTCATAAGGG + Intergenic
933239935 2:79908993-79909015 AACTGACAGTATCCTTATAAAGG - Intronic
933399447 2:81775179-81775201 GTATGACAGCAATGTTGTAAGGG - Intergenic
933508278 2:83205558-83205580 CAATGACAACAACATTAGAAAGG - Intergenic
933661074 2:84927504-84927526 GAATAACCGCAATGTTATAAAGG + Intergenic
933814634 2:86055773-86055795 GACTGTCACCAACCTAATAAAGG + Intronic
935409338 2:102743119-102743141 GAATCACAGCAATATTATCAGGG + Intronic
936289821 2:111214427-111214449 GAATGACAACAATAATATAAAGG - Intergenic
936791063 2:116152815-116152837 GAAAGACATCCACATTATAAAGG - Intergenic
937899449 2:127006644-127006666 GAATGTCCTCAACCTGATAAAGG + Intergenic
937980329 2:127611030-127611052 GCTTGACAGCAACCTCATGAGGG - Intronic
938790786 2:134673606-134673628 TAATCACAGGGACCTTATAAGGG + Intronic
939321767 2:140632339-140632361 GAATGACAGCAATGTTTTAAGGG + Intronic
939441164 2:142251748-142251770 GAAAGACAGCAATATTGTAAGGG + Intergenic
939975451 2:148712387-148712409 GAATGACAGCAATGATACAAGGG - Intronic
940187278 2:151000667-151000689 GAATGACAGAAATGTTATAAAGG + Intergenic
940699036 2:157018977-157018999 GAATGACAGCAAACTCTTATTGG - Intergenic
941031384 2:160515780-160515802 GCAAGACAGCAAATTTATAAAGG + Intergenic
941369754 2:164649989-164650011 GAATGACATCCACATAATAAAGG - Intergenic
941570793 2:167167650-167167672 GAATGACAGCAATGATACAAGGG - Intronic
941695577 2:168547743-168547765 GAATGACAGCAGGCTGAGAATGG - Intronic
942113972 2:172709475-172709497 GACTGACAGCAAACTTATTTGGG - Intergenic
942281322 2:174366750-174366772 GTATGGCAGCAATGTTATAAGGG + Intronic
943926244 2:193784483-193784505 GAATGACAGCAATAATACAAGGG + Intergenic
945630494 2:212269192-212269214 GAATCACAGCAACATTAAAAGGG - Intronic
946055618 2:216899328-216899350 GAGTGACAGCAACGTTGTAAGGG - Intergenic
947349813 2:229231736-229231758 GAATGACAGAAACCTGATTATGG - Intronic
1170146800 20:13184189-13184211 AAGTGACAGTAACCTCATAAAGG + Intergenic
1170515296 20:17123295-17123317 AAATGACAGCAACATCACAAGGG - Intergenic
1170637105 20:18116707-18116729 GAATGACAGCAATGATAGAAAGG - Intergenic
1170753639 20:19176236-19176258 GAATGACAGCAATGTCATAAGGG + Intergenic
1171003359 20:21437909-21437931 GGATGACAGAAACATTCTAATGG - Intergenic
1171127476 20:22615488-22615510 TAATGACTACAATCTTATAAAGG + Intergenic
1171153412 20:22847732-22847754 AAATAACAGCAACCTTATAATGG + Intergenic
1171153511 20:22849101-22849123 GAATAACAGCAACATTATAATGG + Intergenic
1173888954 20:46488468-46488490 GTATGACAGCAACGCCATAAAGG - Intergenic
1175289393 20:57864709-57864731 GAATGAAAGCAATGTTACAAAGG - Intergenic
1176631551 21:9143473-9143495 CAAGGACAGCAACTTTGTAAAGG + Intergenic
1176929120 21:14786955-14786977 GATTGACATAAACCTTAGAATGG - Intergenic
1177167567 21:17619695-17619717 GAGACAAAGCAACCTTATAATGG - Intergenic
1177722191 21:24921596-24921618 GAATGACATCATTGTTATAAGGG - Intergenic
1178504059 21:33149040-33149062 GAATGTCAGAAACTTAATAAAGG - Intergenic
1181109846 22:20595644-20595666 GAATGGCAGCAATGTTATAAGGG + Intergenic
1184888572 22:47365238-47365260 GAATGACAGCAATTTTATAAGGG - Intergenic
1185220200 22:49625464-49625486 GAATGACACCAAAGTTGTAAGGG + Intronic
954585475 3:51732013-51732035 GAATGACAGCAATAATACAAGGG - Intergenic
956230756 3:67013692-67013714 GAATGACAGCAATGTCATGAGGG - Intergenic
957098382 3:75799271-75799293 CAAGGACAGCAACTTTGTAAAGG + Intergenic
957645771 3:82923370-82923392 GAATGACAGCAATGTCAAAACGG + Intergenic
959059963 3:101607329-101607351 GAGTGACAGCAAACCTATATTGG - Intergenic
959886652 3:111510143-111510165 GAATGACAGCAATGTAATAAGGG + Intronic
963232566 3:142923433-142923455 GAATGACAGCAATTTTACAAGGG - Intergenic
963818625 3:149863018-149863040 CAATGACAGTACCCTTATTAAGG + Intronic
963824755 3:149940334-149940356 GAATAACAGCAATGATATAAGGG - Intronic
963879763 3:150515637-150515659 GAATTTCATCAACCTGATAAAGG + Intergenic
964319948 3:155485271-155485293 GAATGTCAGCCACTTCATAATGG + Intronic
964835762 3:160936628-160936650 TAATGGCAGAAACATTATAATGG + Intronic
966275552 3:178161734-178161756 GAATGACAGCAATCACATAAGGG + Intergenic
966764021 3:183442736-183442758 AAATGACAGAAACGTCATAAAGG - Intergenic
967062312 3:185883069-185883091 GAATGACAGAAAACTTACAGAGG + Intergenic
967654368 3:192029035-192029057 AAATGACAGCCATGTTATAAGGG + Intergenic
967960685 3:194921224-194921246 TAATGACAGCAACATCATAAGGG - Intergenic
970233172 4:13932045-13932067 TAATGAAAGCATCTTTATAAGGG + Intergenic
971084697 4:23258884-23258906 GAAAAACAGCAATGTTATAAGGG + Intergenic
971404984 4:26314057-26314079 GAATGACTGCTTTCTTATAAAGG - Intronic
971894097 4:32568128-32568150 GGATGAAAGCAACATTAAAATGG + Intergenic
973039154 4:45449074-45449096 AAATGAGAGCAACATTAAAAAGG - Intergenic
974818168 4:67032936-67032958 GAAGGAAAGCAACCTAATATGGG + Intergenic
975002646 4:69244568-69244590 GGCTGACAGAAACCTCATAAAGG - Intergenic
975010754 4:69348556-69348578 GGCTGACAGAAACCTCATAAAGG - Intronic
976037923 4:80846889-80846911 AAATGACAGCAACATTACAGAGG - Intronic
976314998 4:83650546-83650568 GAATGACAGCAACCAAATAGTGG - Intergenic
976844179 4:89468546-89468568 GAAAAACAGCAACTTTACAATGG - Intergenic
977633334 4:99268032-99268054 GAATAACAGCACCATTTTAAAGG + Intergenic
977854158 4:101867612-101867634 TAATGACAGCAATATCATAAGGG + Intronic
978091799 4:104726335-104726357 GAATTAGAGCAAGCATATAAAGG - Intergenic
979283083 4:118889186-118889208 GAATGAAAGCAACCTGCTGATGG + Intronic
979421030 4:120505404-120505426 CAATCACAGCAACCTTGTAAGGG - Intergenic
980492644 4:133549221-133549243 GAAAGTCAAGAACCTTATAAAGG - Intergenic
981832872 4:149022164-149022186 GAGTGACTACAACCTTAAAAAGG + Intergenic
982218555 4:153105032-153105054 GATAGACAGCAACATAATAATGG - Intergenic
983005045 4:162474444-162474466 GAATGACAACAATATTATAAAGG - Intergenic
983185898 4:164700330-164700352 GATTGTCAGCATCCTTTTAAAGG + Intergenic
984000047 4:174229261-174229283 GAATGAAACCAAGCTTATATTGG - Intergenic
1202756637 4_GL000008v2_random:69584-69606 CAAGGACAGCAACTTTCTAAAGG - Intergenic
987123244 5:14787626-14787648 AAATGAAAGCAACTTTATCAAGG + Intronic
987153700 5:15066475-15066497 GAATGATAGCAATGTTATAAGGG + Intergenic
988696733 5:33628952-33628974 GAAAGACATCCAACTTATAATGG + Intronic
990390453 5:55314477-55314499 GAAAGACAGCAACATTAGAAGGG + Intronic
990472785 5:56132066-56132088 GAATGACAGCAATCATACTAGGG + Intronic
991160499 5:63493651-63493673 TAATGATAGCAATATTATAAAGG - Intergenic
991647270 5:68813399-68813421 GAATGACTGCAATGTCATAAGGG - Intergenic
992264246 5:75002615-75002637 GAATGACAGCAAAGATACAAGGG - Intergenic
992976820 5:82129760-82129782 GATTGACAGACACCTCATAAAGG - Intronic
995575690 5:113530567-113530589 GAATGACAGCAATGATACAAGGG - Intronic
995604043 5:113832061-113832083 GAATGACAGCCATGTTACAAGGG + Intergenic
996113055 5:119587816-119587838 GAAAGACAGCCACTTTATACGGG - Intronic
996233522 5:121097112-121097134 AAATGACAGCAATAATATAAGGG + Intergenic
996458738 5:123716394-123716416 AAATGACATCACCCTTATAAAGG - Intergenic
997168540 5:131689504-131689526 GAATGACAGCAATGTTATAAGGG + Intronic
997729627 5:136158297-136158319 GAAAGACAGGAAACATATAAAGG + Intronic
998982995 5:147725381-147725403 AAATGAAAGCAAGCTTATTAAGG - Intronic
999045292 5:148460950-148460972 GAATGACAGCAATGAAATAAGGG + Intronic
999977872 5:156929810-156929832 GAATGAAAGCAACCTTAAACAGG + Intronic
1001006100 5:168051779-168051801 GATGGACAGCAAGCTTATGAGGG - Intronic
1001869885 5:175142977-175142999 GAGTGACAGCAACATCACAAGGG + Intergenic
1004089268 6:12483548-12483570 GAATGACAGCAGTCTTTTAATGG + Intergenic
1004213172 6:13673585-13673607 GAATAACAGCAATGCTATAAGGG + Intronic
1004809072 6:19239410-19239432 GAATGACAGAAACCTCATATAGG + Intergenic
1005222544 6:23603461-23603483 GAATGAAAGCAATAATATAAGGG + Intergenic
1006760707 6:36458003-36458025 AAATGCCAGCAACCTTATGATGG - Intronic
1007243809 6:40445626-40445648 CAATTACAGAAACCTTTTAAAGG + Intronic
1009298232 6:61982058-61982080 GAATGACAAAAAGCTTAAAATGG - Intronic
1009709541 6:67300050-67300072 GACTGACAGACACCTTATACAGG - Intergenic
1010480713 6:76349681-76349703 TAATAACAGCAACCCTTTAATGG - Intergenic
1011091669 6:83609549-83609571 TAATGACAGCAATTATATAATGG + Intronic
1012161724 6:95893146-95893168 GAATGACAGCAATGTTATAAAGG - Intergenic
1013572257 6:111440540-111440562 TAATGGCAGCAATTTTATAAGGG - Intronic
1013707969 6:112861807-112861829 GAATGACAACAATATTATGAGGG + Intergenic
1017659596 6:156661098-156661120 GAATGACAGCAATGCTACAATGG + Intergenic
1020459333 7:8411049-8411071 GAAAAACAGTAACTTTATAATGG + Intergenic
1021078620 7:16335748-16335770 GAAAGACAACAACCATATACAGG + Intronic
1021548963 7:21849270-21849292 GAATGACAGCAATGTTATAAAGG - Intronic
1021605439 7:22405113-22405135 GAATAACAGCCACCTTATGGAGG + Intergenic
1021832749 7:24633024-24633046 GAATGGCAGCAATATTATATGGG - Intronic
1022064879 7:26843336-26843358 GCATTATAGAAACCTTATAAGGG - Intronic
1022430661 7:30316641-30316663 AAATGACAGCGACTTAATAAAGG - Intronic
1022633426 7:32107844-32107866 CAGTAACAGCAATCTTATAAGGG + Intronic
1023097480 7:36675962-36675984 GAATGTCCTCAACCTAATAAAGG + Intronic
1023367820 7:39481772-39481794 GACTGATAGCAATGTTATAAGGG - Intronic
1023877694 7:44297111-44297133 GAAAGAAAGCAACATTATCAGGG + Intronic
1024623098 7:51180290-51180312 CAAGGTCAGCAACCTTGTAAGGG - Intronic
1024681996 7:51700152-51700174 GAATTACAGCAATGTTACAAAGG + Intergenic
1024749003 7:52441399-52441421 GAATGACATCAAAATAATAATGG - Intergenic
1024749141 7:52443973-52443995 GAATGACTACAACATTTTAAGGG - Intergenic
1026189086 7:68108327-68108349 GAAGGACAGCAGTCATATAAAGG + Intergenic
1027344986 7:77250110-77250132 GAATGACAGCAATGATACAAGGG - Intronic
1027728080 7:81832833-81832855 TAATGACAGCAAGATTATAAGGG + Intergenic
1028865965 7:95712412-95712434 GAATGACAGCAATTTTTTAAGGG + Intergenic
1028926931 7:96368442-96368464 GAATGACAGCAATGATACAAGGG - Intergenic
1029875003 7:103741323-103741345 GCATTACAGCAACATCATAAAGG - Intronic
1032655177 7:133920601-133920623 CAATGACAGCAATGTTACAAAGG - Intronic
1033856894 7:145573803-145573825 GAAGGACAGCTATCTTACAAGGG - Intergenic
1034608670 7:152344118-152344140 GACTGACAGCAACAATACAAGGG + Intronic
1035890117 8:3334154-3334176 AAATGACATCAACCTTTTCAAGG + Intronic
1037395909 8:18442693-18442715 GAATGACAGCAATGATACAAGGG - Intergenic
1038660611 8:29493504-29493526 GAATGGCCACAACCTTAGAAAGG + Intergenic
1039230551 8:35442229-35442251 GAATGGCAGCAAGGTTATGAAGG - Intronic
1041004857 8:53487893-53487915 ACATAACAGCAGCCTTATAAGGG + Intergenic
1042384644 8:68159599-68159621 TGAGGACAGAAACCTTATAAAGG + Intronic
1043177326 8:77038599-77038621 GAATAACATCTACATTATAAAGG - Intergenic
1043607171 8:82015589-82015611 GTATTACAGCAACCAAATAAAGG - Intergenic
1043975803 8:86583290-86583312 GAAAGACAGCAATGTCATAAGGG + Intronic
1045805455 8:106155511-106155533 GAATGATAGGAACTTTGTAAAGG - Intergenic
1047927386 8:129694819-129694841 GAATGTCAGCAACCATCTGAGGG + Intergenic
1048218436 8:132518256-132518278 GCATGAGAGCCACCTTATGAGGG + Intergenic
1048949349 8:139481691-139481713 TAAAGACAGCCACCTTATTAAGG + Intergenic
1050109895 9:2203856-2203878 GAATGACAACAATGTTATAAGGG + Intergenic
1051200519 9:14616337-14616359 GATTGACAGCAAGAATATAATGG + Exonic
1055075276 9:72208291-72208313 GAATGTAAGCAACCTTCTCAAGG + Intronic
1055834505 9:80422340-80422362 GAATAATAGTATCCTTATAATGG + Intergenic
1055881219 9:81006277-81006299 GAAAGACAACAACATTATAAGGG + Intergenic
1056087389 9:83164392-83164414 TAATGACAGCAATGATATAAGGG + Intergenic
1056088254 9:83177890-83177912 GCATGCCAGCAACCATGTAATGG - Intergenic
1056996362 9:91464452-91464474 GAATGACAGCAATGTCACAAGGG - Intergenic
1057136155 9:92689411-92689433 GAATGTCAGCAATGTTTTAAGGG - Intergenic
1058057277 9:100461955-100461977 GAAAGAAAGTAACTTTATAATGG - Intronic
1059381061 9:113925809-113925831 GAATGACAGCAATGTTATAAGGG - Intronic
1060486922 9:124053674-124053696 GAAAGATAGCATCATTATAATGG + Intergenic
1203754381 Un_GL000218v1:111077-111099 CAAGGACAGCAACTTTGTAAAGG + Intergenic
1186291066 X:8099705-8099727 AAATGATAGCAATATTATAAAGG + Intergenic
1187352120 X:18529325-18529347 GAATAATAGTAACGTTATAAGGG - Intronic
1187643861 X:21324951-21324973 AAATGAGAGCAATGTTATAAGGG - Intergenic
1187973797 X:24685443-24685465 GAATGACAGTAACGTCACAAGGG + Intergenic
1188014722 X:25095922-25095944 AATTGACAGCAACCCAATAATGG - Intergenic
1188122323 X:26323080-26323102 GAATGATAGCAGTGTTATAAGGG + Intergenic
1188280516 X:28262539-28262561 GAATGACAGCAATGATAAAAGGG + Intergenic
1188457329 X:30381086-30381108 GAATGACAGCAATGTAATAAGGG - Intergenic
1188767591 X:34115084-34115106 GAATGACAGCAATGATGTAAGGG - Intergenic
1189445056 X:41073320-41073342 GAATGACAGCAATGTTATAGGGG - Intergenic
1189934062 X:46046834-46046856 GAATGACAGCAAAGATACAAGGG + Intergenic
1190139035 X:47825200-47825222 AAATGACAGCAACATTATAAAGG + Intergenic
1191693938 X:63968856-63968878 GAATGACATCAATGTTATAAGGG + Intergenic
1192054850 X:67762796-67762818 GAATAATAGCAATATTATAAGGG + Intergenic
1192096365 X:68216072-68216094 GAATGATAGTACCATTATAAGGG + Intronic
1192110710 X:68360906-68360928 GAATGACAACAATATCATAAGGG + Intronic
1192872936 X:75202208-75202230 GAATGACAGCAATTATAGAAGGG + Intergenic
1193281966 X:79662253-79662275 GAATGACAATAATTTTATAAAGG - Intergenic
1193611928 X:83642916-83642938 GAACTACCTCAACCTTATAAAGG - Intergenic
1193863978 X:86706321-86706343 AAATGAGAGCAATGTTATAAAGG + Intronic
1194870265 X:99122558-99122580 GAATGAAATTAACCTGATAAAGG + Intergenic
1194909723 X:99626534-99626556 GAATGACAGCAACATTGCAAGGG + Intergenic
1196853136 X:119958053-119958075 AAAGGACAGCAATGTTATAAGGG - Intergenic
1196853138 X:119958071-119958093 GAATGACAGCAATGTTATAAAGG - Intergenic
1197012097 X:121577931-121577953 GAATGACAGCAACACTATTGGGG + Intergenic
1197095805 X:122593629-122593651 GAATGACTGAAATGTTATAAGGG + Intergenic
1198538514 X:137610869-137610891 GAATGACAGCAATGTTATAAGGG - Intergenic
1198890438 X:141389244-141389266 CAATGACTGCAACCATTTAATGG - Intergenic
1199006593 X:142705971-142705993 GAATGACAACAATGTTACAAGGG + Intergenic
1199418453 X:147614816-147614838 GAACTACAACAACCTTCTAATGG - Intergenic
1199795287 X:151190059-151190081 GAATGACGGCAATATTATTAGGG + Intergenic
1200701245 Y:6404298-6404320 GAAAGGCAGCAACCTCAAAAAGG + Intergenic
1201032867 Y:9760400-9760422 GAAAGGCAGCAACCTCAAAAAGG - Intergenic
1201168011 Y:11228725-11228747 CAAAGACAGCAACTTTGTAAAGG + Intergenic
1202095443 Y:21244425-21244447 GAATGACAGCCACCTTTTCTGGG + Intergenic
1202176049 Y:22099752-22099774 GAAAGGCAGCAACCTCAAAAAGG + Intergenic
1202215312 Y:22486632-22486654 GAAAGGCAGCAACCTCAAAAAGG - Intergenic