ID: 1068053280

View in Genome Browser
Species Human (GRCh38)
Location 10:51979706-51979728
Sequence CATCCTCCCAAGACTGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7592
Summary {0: 1, 1: 9, 2: 140, 3: 1202, 4: 6240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068053280 Original CRISPR CATCCTCCCAAGACTGAGTC AGG (reversed) Intronic
Too many off-targets to display for this crispr