ID: 1068058061

View in Genome Browser
Species Human (GRCh38)
Location 10:52035309-52035331
Sequence TGGTGTGTAGGGAAGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068058051_1068058061 7 Left 1068058051 10:52035279-52035301 CCAGTCCTGGGTGGGGCAAATCC 0: 113
1: 18
2: 8
3: 14
4: 396
Right 1068058061 10:52035309-52035331 TGGTGTGTAGGGAAGGAAGGGGG No data
1068058052_1068058061 2 Left 1068058052 10:52035284-52035306 CCTGGGTGGGGCAAATCCTTGAG 0: 11
1: 86
2: 30
3: 13
4: 221
Right 1068058061 10:52035309-52035331 TGGTGTGTAGGGAAGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068058061 Original CRISPR TGGTGTGTAGGGAAGGAAGG GGG Intronic
No off target data available for this crispr