ID: 1068058799

View in Genome Browser
Species Human (GRCh38)
Location 10:52040340-52040362
Sequence CAGATTATGAAATGTGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068058799 Original CRISPR CAGATTATGAAATGTGTTAC AGG (reversed) Intronic
900804821 1:4760689-4760711 ATGACTATGAAATGGGTTACAGG - Intronic
907380070 1:54079841-54079863 CAAATTATGCTATGTGTTTCAGG + Intronic
908340239 1:63170919-63170941 CATATTAAGAAATATGTTAGAGG - Intergenic
908693383 1:66808124-66808146 CAAATCATGAAATGTCTTGCAGG - Intergenic
909825485 1:80121260-80121282 CTGAAGAGGAAATGTGTTACTGG - Intergenic
910496087 1:87829736-87829758 TAGATTATCAGATGTGTTAATGG + Intergenic
915669293 1:157474571-157474593 CAGATGATTTAATTTGTTACTGG + Intergenic
916319540 1:163488286-163488308 CATATTATAAAATATCTTACGGG - Intergenic
916706501 1:167356532-167356554 CACAGCATCAAATGTGTTACCGG + Intronic
920558336 1:206920610-206920632 CAGAGTATGAAAGGGGATACAGG + Intronic
922380303 1:225016933-225016955 CAGTTTATGAATTGTTTTCCTGG + Intronic
924476191 1:244383826-244383848 CAGAGTATGAAAGACGTTACAGG + Intronic
1066025388 10:31353007-31353029 CAGTTTCTGAAATGTGGTAATGG - Intronic
1066177848 10:32927922-32927944 AAGATTATTAAACGTGTGACTGG + Intronic
1067005784 10:42660396-42660418 CACATTAGGAAATGTGACACTGG + Intergenic
1068058799 10:52040340-52040362 CAGATTATGAAATGTGTTACAGG - Intronic
1070487091 10:76941775-76941797 CAGATTATGGTGTTTGTTACAGG - Intronic
1071061445 10:81574685-81574707 CAGATTCTGAGATGGGGTACAGG - Intergenic
1074649335 10:115501380-115501402 CAGGTTATGAACCCTGTTACAGG + Intronic
1076795539 10:132796386-132796408 CAATTTAGGAAATGTGTCACAGG + Intergenic
1078506719 11:11955891-11955913 AAGATAATGAAATCTGTTACTGG - Intronic
1078757174 11:14222176-14222198 GAGATTATGAAATGTTATAATGG - Intronic
1081563893 11:44244278-44244300 CAGCTTATGAAACGTGTCATTGG + Exonic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1094110003 12:26852600-26852622 CTGATTTTTAAATGTGTAACAGG + Intergenic
1094739028 12:33267622-33267644 CAGGTTATGAGATGTTTTTCAGG - Intergenic
1095123557 12:38446900-38446922 CACATAGTGGAATGTGTTACAGG - Intergenic
1095707577 12:45254241-45254263 AAGATTATGAATTGAGTTGCAGG + Intronic
1096004071 12:48154635-48154657 CAGATTTTAAAATGAGTTAAAGG + Intronic
1096915519 12:55027709-55027731 CAGATTATGCAATGAGTTTTTGG - Exonic
1097124007 12:56758821-56758843 AAGATTAGAAAATATGTTACAGG + Intronic
1097866544 12:64563835-64563857 CAGAGTATGTAATATGTTAGAGG - Intergenic
1098534026 12:71574647-71574669 CAGATTTTGAAGAGTGTTGCTGG - Intronic
1098782088 12:74700214-74700236 CAGTTTAAGAACTGTGTTAGGGG + Intergenic
1099181287 12:79474563-79474585 CATATTAGGAACTGTATTACTGG - Intergenic
1099651737 12:85437257-85437279 CATATTCTGAAATGTGATTCAGG + Intergenic
1099836879 12:87917770-87917792 GAGATTATTAAATGTTTTAATGG + Intergenic
1101750327 12:107578163-107578185 AAGATTTTTAAATGAGTTACTGG + Intronic
1102276628 12:111587153-111587175 CTGATTTCGAAATGTGTTTCAGG + Intronic
1103539783 12:121658264-121658286 CTGAATATTAAATGTGTTTCAGG + Intronic
1107037649 13:35917879-35917901 CAAATTCTGAAATGTGTGTCAGG - Intronic
1107594800 13:41951874-41951896 CAGATAAAGAAATTTATTACAGG + Intronic
1110227462 13:73134829-73134851 CAGATTATGAGTTGTTTTCCTGG + Intergenic
1110530030 13:76586282-76586304 CAGATTATGACATATATTATTGG - Intergenic
1111825770 13:93265000-93265022 CAGATTATGAAATTTCTTAGAGG + Intronic
1111989265 13:95100571-95100593 CAGTTGATGACATGAGTTACTGG - Intronic
1115095950 14:29635890-29635912 CAGACTATGATATTTGTAACAGG + Intronic
1115595319 14:34903553-34903575 CAGATCATAAAATATGTTACAGG + Intergenic
1115998944 14:39222357-39222379 AAGTTTAAGAAATATGTTACTGG + Intergenic
1116261601 14:42635486-42635508 TAGATTATGAAATGTCATAAAGG + Intergenic
1117233754 14:53749907-53749929 CAGATTAAGAAATTTCTAACTGG + Intergenic
1117625472 14:57633041-57633063 CAGATTATGAAATGACATAGAGG - Intronic
1117682203 14:58215715-58215737 TTGATTCTGAAATGTGTCACTGG + Intronic
1120550577 14:85867095-85867117 CTGATTATGAAATGTCTGAAAGG + Intergenic
1123899239 15:24859581-24859603 CAAATTAATAGATGTGTTACAGG + Intronic
1126774165 15:52085597-52085619 AATATTAAGAAATATGTTACAGG - Intergenic
1130685131 15:86030623-86030645 CATATTAAGAAATGTATTGCTGG - Intergenic
1131040251 15:89257978-89258000 CAGATTATGAAGAATCTTACAGG - Intronic
1131617582 15:94032908-94032930 TAGATTATGAAATTTCTTAGTGG + Intergenic
1132158746 15:99516947-99516969 TAGATTATGAAGTTTATTACAGG + Intergenic
1132440222 15:101855820-101855842 CAGATTATAAAATGGTTTACAGG + Intergenic
1137934455 16:52621040-52621062 CAGATTCTGAATTGCTTTACAGG - Intergenic
1138002449 16:53295939-53295961 CAGATTATGAAATGCTCTAAAGG - Intronic
1139622899 16:68161431-68161453 CAGATTATGAAGTATGTTCATGG - Intronic
1140024974 16:71279294-71279316 CAGATTATAAAAAAGGTTACAGG + Intergenic
1140971209 16:80014554-80014576 CTGATTGGGGAATGTGTTACTGG - Intergenic
1141148775 16:81550211-81550233 CAGATCATGCAATGAGTAACTGG - Intronic
1141306203 16:82866264-82866286 CAAATTTGGAAATGTGTAACAGG - Intronic
1141605077 16:85148214-85148236 CATATTCTGAAATGAGATACAGG - Intergenic
1150019950 17:61601691-61601713 CAGATTGCGAAACATGTTACAGG - Intergenic
1150068666 17:62133388-62133410 CAGATTATGTAATATGTTCTAGG - Intergenic
1154234754 18:12594133-12594155 CAAAGTAGGAAATGTGTTATGGG + Intronic
1155609426 18:27648262-27648284 TAGGCTATTAAATGTGTTACTGG + Intergenic
1156580317 18:38367454-38367476 CAGGTTCTGTAATGTGTTACAGG - Intergenic
1156833903 18:41529457-41529479 CAGAATATGAGATGTCTGACAGG - Intergenic
1164891367 19:31826327-31826349 CTGATTATGATATGGATTACTGG - Intergenic
1165906847 19:39199430-39199452 CAGATTTTGAAATGTGCCAGGGG + Intronic
1166399422 19:42467179-42467201 CAGAATCTCACATGTGTTACAGG - Intergenic
925370381 2:3340587-3340609 TATATTATAAAATGTGTAACAGG - Intronic
927388038 2:22558989-22559011 CAGATTATTATAGGTGTTAGAGG + Intergenic
930238407 2:48909747-48909769 CAGTTTTTGTAATGTCTTACTGG + Intergenic
930288032 2:49458473-49458495 AAGATTACTAAATGTGTTATAGG + Intergenic
930493963 2:52113587-52113609 AAGATTATAAAATGTATGACAGG + Intergenic
932707341 2:74036952-74036974 TAGATTTTAAAATGTTTTACTGG + Intronic
933969015 2:87455139-87455161 CAGATTTTGTAATGTGCTACAGG - Intergenic
933996789 2:87676067-87676089 AAGATTGTAAAAGGTGTTACTGG - Intergenic
936297062 2:111274843-111274865 AAGATTGTAAAAGGTGTTACTGG + Intergenic
936324776 2:111495368-111495390 CAGATTTTGTAATGTGCTACAGG + Intergenic
937763602 2:125633939-125633961 AAGATTATCATCTGTGTTACTGG + Intergenic
938007265 2:127797531-127797553 TATATTATGAAATGTTTTAGTGG + Intronic
938976331 2:136481757-136481779 AAGAAAATGAAATGTGATACAGG + Intergenic
940201325 2:151154160-151154182 CAGAATATGAAGTGTGTTTTCGG + Intergenic
941613214 2:167686949-167686971 CAGATTAAGAAATGTCTCTCTGG - Intergenic
945684571 2:212953582-212953604 CAGATCATGACATGTGTGAAAGG + Intergenic
945694470 2:213085671-213085693 CAGATTATGTTATGGGTTTCAGG - Intronic
1171103700 20:22411592-22411614 CAAATTTTGAAGTGTGTTAGTGG + Intergenic
1171800154 20:29605083-29605105 CAGATTAAGATGTGTGTCACAGG + Intergenic
1173641081 20:44602365-44602387 CAGATTATGGTATGTGCTATGGG - Intronic
1177398148 21:20563870-20563892 CAGACTCTGATATGTTTTACTGG + Intergenic
1178981531 21:37268617-37268639 AAGAATATAAAATGTTTTACAGG + Intergenic
1182172411 22:28245814-28245836 CTGATTGTGAAAGGTCTTACTGG - Intronic
949164838 3:927230-927252 CATATTATGAAATTTATTTCTGG + Intergenic
949444585 3:4120317-4120339 CAGATTTTGAAAGGTGTTTTAGG - Intronic
950912734 3:16611746-16611768 CAGATTAAGAAAGGTGGTACCGG + Intronic
952518761 3:34132948-34132970 CAGAATATAAACTGTGTTTCTGG - Intergenic
952974862 3:38685120-38685142 CAGATTCTAAAATGTGTCATTGG + Intergenic
957597145 3:82281517-82281539 TAAATTATGCAATGTGATACAGG + Intergenic
957982011 3:87522573-87522595 CATATTATGTACTGTGTCACTGG + Intergenic
961137791 3:124528021-124528043 CAGATTCTGAATAGTGTGACAGG + Intronic
961430178 3:126875735-126875757 CAGTTTATGCAGTGTGTTAAAGG + Intronic
965093689 3:164194277-164194299 CATATTTTGAATTGTTTTACTGG - Intergenic
965377021 3:167937447-167937469 CAGATTATGACATTTGTATCTGG - Intergenic
969973089 4:11068367-11068389 CAGATTATGTAGTGTGTTGGTGG - Intergenic
971089699 4:23326935-23326957 CAAATTATGAAAAGTGTTCTAGG + Intergenic
971643648 4:29167255-29167277 CAGATTACGAATTGTTTTTCTGG - Intergenic
971981023 4:33750561-33750583 CAAAGTTTGAAATGTATTACTGG - Intergenic
972663594 4:41142436-41142458 CAGAAAATGAAATGTGTTGGTGG + Intronic
974154773 4:58056731-58056753 CAGATGATGACAAATGTTACAGG - Intergenic
974417191 4:61624051-61624073 CAGATCATGCAAGGTCTTACTGG + Intronic
975561736 4:75714802-75714824 CAGAATAAGAAATGTGATGCTGG + Intronic
975868737 4:78753938-78753960 CAGATTTTGATGTGGGTTACAGG + Intergenic
975923111 4:79416668-79416690 AAAATGATGAAATGAGTTACTGG + Intergenic
976126586 4:81839660-81839682 CTAATTATGAAATGTGTTTATGG - Intronic
976142289 4:82004689-82004711 CAGAGCCTGAAATGTGTTCCTGG + Intronic
976473243 4:85454088-85454110 CAGATGAAGAAATGTTTGACTGG + Intergenic
978366346 4:107987054-107987076 CTGATTATGAAAGGTATTATGGG - Intergenic
978631807 4:110756269-110756291 TAGATTATGAAATTTGATGCTGG + Intergenic
981868708 4:149460393-149460415 TAGATTATGAAATTTTTTAATGG - Intergenic
984043560 4:174768818-174768840 CAGATAATGAAATGTTTTGAAGG - Intronic
984940187 4:184924509-184924531 CAAGTCATGAAATCTGTTACTGG - Intergenic
986121955 5:4847556-4847578 CAGATTAAGAACTGTTTTAATGG - Intergenic
987454925 5:18131877-18131899 CACATTAATTAATGTGTTACAGG - Intergenic
987492175 5:18595070-18595092 CAGCTTTGGAAATGTGTAACAGG - Intergenic
989217563 5:38921004-38921026 CTGCTTCTGAGATGTGTTACAGG - Intronic
990274274 5:54178861-54178883 CACATTACAAAATGTGTTACGGG + Intronic
991517215 5:67450651-67450673 CACCTTATGAATTGTGTTAGGGG - Intergenic
993312042 5:86346438-86346460 GAAATTATGTATTGTGTTACAGG + Intergenic
994410310 5:99399932-99399954 CAGATTCTTAAATCTGTTTCTGG + Intergenic
994434904 5:99715617-99715639 CAGATTCTGAAATGTATGTCTGG - Intergenic
994472919 5:100232397-100232419 CTGATTATACAATGTATTACAGG - Intergenic
996014470 5:118517416-118517438 AACATTATCAAATGTGTTGCTGG + Intergenic
996252883 5:121359128-121359150 CAGTTTAACAAATGTGCTACAGG - Intergenic
999580268 5:153030776-153030798 CAGATAATAAAAAGTATTACTGG + Intergenic
1000457817 5:161473845-161473867 CAGACTAGGAAATGTGCTAAGGG + Intronic
1001197166 5:169684209-169684231 CAGATTATGCAATGTATTCCCGG + Exonic
1003297914 6:4850184-4850206 CAGAGAATGAATTGTGATACTGG - Intronic
1004206337 6:13594788-13594810 CAGTTTATGAAATGGGTACCAGG - Intronic
1004767879 6:18751688-18751710 CAGATTATAAAATGTGCTAAAGG + Intergenic
1005115339 6:22329778-22329800 GAGATCATGAACTATGTTACAGG - Intergenic
1005720311 6:28595036-28595058 CAAGTTATGAAATGTGTACCTGG + Intronic
1005877535 6:30023783-30023805 CAGATTAGGAGATGTGGGACAGG + Intergenic
1009841582 6:69083545-69083567 CAAATTATGTAATGTGTTAAAGG + Intronic
1012413805 6:98990475-98990497 CAGATTATGACATATATTATTGG + Intergenic
1013098053 6:106963848-106963870 CAAATTATGAAAGGCCTTACAGG + Intergenic
1016189983 6:141253099-141253121 CTGATTCTGAAATATGTTCCCGG - Intergenic
1016312076 6:142744856-142744878 CAGAACATTAAAAGTGTTACAGG - Intergenic
1017323507 6:153119798-153119820 TTGAATATGAAATGTGTTCCAGG + Intronic
1018189906 6:161301511-161301533 GAGGTTATGAAATATGTTGCTGG - Intergenic
1020038343 7:4980520-4980542 CTGGTTATGAAATGTAATACAGG + Intergenic
1020156905 7:5733628-5733650 CTGGTTATGAAATGTAATACAGG - Intronic
1020647045 7:10827078-10827100 AAGATAATGAAATGTGTTTTTGG + Intergenic
1020719066 7:11718398-11718420 CATATTATCAGATGTGTCACAGG + Intronic
1020983655 7:15104880-15104902 CAGCCAGTGAAATGTGTTACTGG - Intergenic
1021719567 7:23492244-23492266 CAGATTCTAAAAGGTGTTCCTGG - Intergenic
1022320340 7:29281866-29281888 CACAACATGAGATGTGTTACAGG - Intronic
1028346235 7:89787226-89787248 GTCATTATGAAATGTGTTAAAGG - Intergenic
1028420704 7:90629556-90629578 CAAATAATGAAGTGTGCTACTGG + Intronic
1028674116 7:93439128-93439150 CAGATTAAGAAATGTGTCTTAGG + Intronic
1031352277 7:120748791-120748813 CAGATAATGCACTGTGTCACAGG - Exonic
1031536794 7:122944227-122944249 CTGATTATAAGATGTGTTAGTGG + Intergenic
1031823287 7:126531328-126531350 CACATTATAAAATATGTTAATGG - Intronic
1031996599 7:128236135-128236157 CAGATTATAAAATGTTTCACTGG + Intergenic
1032429122 7:131846643-131846665 CAGATTATGAGACGAGATACTGG + Intergenic
1034841214 7:154399355-154399377 AAAATTAAGAAAAGTGTTACAGG - Intronic
1036061332 8:5324710-5324732 CAGTGTATGAAAAATGTTACAGG - Intergenic
1036561036 8:9900646-9900668 CAGATTTAGAAATGTGTCAAAGG - Intergenic
1036731262 8:11267342-11267364 CAGATTATTAAATATATTGCTGG - Intergenic
1037169349 8:15872998-15873020 CAGATTCTGAAATTTGATAAGGG + Intergenic
1037268916 8:17103545-17103567 GAGTTTATGAAATGAGTTAATGG + Intronic
1038102632 8:24395948-24395970 CAGATTATGAAATGATTGTCAGG - Intronic
1042782447 8:72506935-72506957 CAGAATATAAAAGGTTTTACAGG + Intergenic
1043776423 8:84276276-84276298 CAAATACTGAAATGTGTTATTGG + Intronic
1044074950 8:87809084-87809106 CAGAGTTTGACATGTGTTAGAGG + Intergenic
1046901619 8:119529647-119529669 CAGATAATTAAATGTTTTATAGG - Intergenic
1048646366 8:136425867-136425889 CAGATTATGAATTGTTTTCCTGG + Intergenic
1050348008 9:4712154-4712176 CAGGTTAAGAAATGTGTTTTAGG - Exonic
1050718028 9:8552384-8552406 CAGAGTATGACATGTGTTTTTGG + Intronic
1051075454 9:13228672-13228694 ATGATTATGAAATTTGTTACAGG - Intronic
1052320959 9:27167069-27167091 CAGATTATGATATAAGTTAAGGG + Intronic
1052493141 9:29192164-29192186 CATATTATGAATTCTGCTACAGG + Intergenic
1052583337 9:30390643-30390665 CAGCTCTTGAAATGTTTTACTGG - Intergenic
1055524893 9:77122732-77122754 CTGACTATGAAATTTGTCACTGG + Intergenic
1056992190 9:91422992-91423014 CAGATTATGCAATGTATGAAAGG + Intronic
1057332354 9:94127852-94127874 CAGCTTAGGAATTGTGTAACAGG + Intergenic
1058232518 9:102446741-102446763 CATATTATGAAATCTGTTTTTGG - Intergenic
1059018006 9:110543215-110543237 GAGATTAGGAAATGTGGAACTGG - Intronic
1059410711 9:114130523-114130545 AAGGTAAGGAAATGTGTTACTGG - Intergenic
1061173281 9:128975096-128975118 CAGATTTAGAAAGCTGTTACAGG - Intronic
1185813290 X:3130317-3130339 CAGGTTATGAAATCAGTTCCAGG - Intergenic
1186475000 X:9850403-9850425 CAGGTTATGAAGTGAGTTAGCGG + Intronic
1186710824 X:12194509-12194531 CCCGTTATGAAGTGTGTTACAGG + Intronic
1188017003 X:25117047-25117069 AAGATTATTAAATGCATTACTGG - Intergenic
1188577176 X:31665722-31665744 CAGACTAGTAAATGTGTTATCGG + Intronic
1188904003 X:35770057-35770079 CACCTTCTGTAATGTGTTACAGG + Intergenic
1189399328 X:40651538-40651560 CAGAATATTAAATTTATTACTGG + Exonic
1189605010 X:42667946-42667968 CAGAATAAGAATTGTGTTTCTGG - Intergenic
1194138324 X:90176026-90176048 CAGACTATCAAATATGTTAAAGG + Intergenic
1198496808 X:137201501-137201523 CAGATTGGGAAATTTTTTACAGG + Intergenic
1198828876 X:140727938-140727960 CACATTAAGACATGTCTTACAGG + Intergenic
1200484121 Y:3746265-3746287 CAGACTATCAAATATGTTAAAGG + Intergenic
1201268309 Y:12230209-12230231 CAGGTTATGAAATCAGTTCCAGG + Intergenic
1202282552 Y:23205093-23205115 CAGATTAAGAAAGGTAGTACTGG + Intergenic
1202283339 Y:23213426-23213448 CAGATTAAGAAAGGTAGTACTGG - Intergenic
1202434225 Y:24819478-24819500 CAGATTAAGAAAGGTAGTACTGG + Intergenic
1202435014 Y:24827812-24827834 CAGATTAAGAAAGGTAGTACTGG - Intergenic