ID: 1068064776

View in Genome Browser
Species Human (GRCh38)
Location 10:52115761-52115783
Sequence CTGGGTATACAGAAGGGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068064776_1068064785 27 Left 1068064776 10:52115761-52115783 CCTTTACCCTTCTGTATACCCAG 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1068064785 10:52115811-52115833 ATATTCAGAAACTTTATTTTTGG No data
1068064776_1068064786 28 Left 1068064776 10:52115761-52115783 CCTTTACCCTTCTGTATACCCAG 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1068064786 10:52115812-52115834 TATTCAGAAACTTTATTTTTGGG No data
1068064776_1068064780 -6 Left 1068064776 10:52115761-52115783 CCTTTACCCTTCTGTATACCCAG 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1068064780 10:52115778-52115800 ACCCAGCAACTTGGACTATCTGG No data
1068064776_1068064784 1 Left 1068064776 10:52115761-52115783 CCTTTACCCTTCTGTATACCCAG 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1068064784 10:52115785-52115807 AACTTGGACTATCTGGCTCAGGG No data
1068064776_1068064783 0 Left 1068064776 10:52115761-52115783 CCTTTACCCTTCTGTATACCCAG 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1068064783 10:52115784-52115806 CAACTTGGACTATCTGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068064776 Original CRISPR CTGGGTATACAGAAGGGTAA AGG (reversed) Intronic
900803787 1:4754418-4754440 GTGGGTAGCCAGAAGGGAAAGGG - Intronic
901037279 1:6343900-6343922 CTGGGTGTACAGAGGGGTGTGGG + Intronic
902568186 1:17329209-17329231 CTGTGTATACAGGAGGCTGAGGG + Intronic
904608590 1:31712769-31712791 CTGGCTAGAAAGAAGGCTAAGGG + Intergenic
904852346 1:33468483-33468505 CTGAGGAGTCAGAAGGGTAAAGG + Intergenic
906922016 1:50074769-50074791 CTGGGTAGACAGAACAGTAAAGG + Intronic
907736261 1:57115662-57115684 CTGGGTATTCAGAAAGGAAAAGG + Intronic
908436974 1:64116650-64116672 CTGGGTATATTGAAAGGAAAAGG + Intronic
909584973 1:77279950-77279972 GTGGGTATATAGAAGGCTCATGG - Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
916097226 1:161362161-161362183 GTGGGTTTTGAGAAGGGTAAAGG + Intronic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916314862 1:163437960-163437982 CTCGGTTTACAGACGGGGAATGG - Intergenic
916763197 1:167835280-167835302 CAGAGGACACAGAAGGGTAAAGG - Intronic
916995192 1:170289264-170289286 ATGGCAATACAGAAGGGGAATGG - Intergenic
917495612 1:175537705-175537727 ATGGGGATACAGAAGGGTTTTGG - Intronic
920050582 1:203162354-203162376 CTGGGTGGTCAGAAGGGTGAGGG + Intronic
920949937 1:210563174-210563196 GAGGGAATACAGAAGGGTACTGG + Intronic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
922331379 1:224579900-224579922 CTGGGTATAAAGAAAAGAAAAGG - Intronic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
1063176182 10:3552772-3552794 CTGGGTCTTCAGAAGTGAAAGGG - Intergenic
1064166250 10:12988783-12988805 CTGGGGATACAAAAGGGAACAGG - Intronic
1067272650 10:44805426-44805448 CTGGGGATCCAGCAGGGGAAAGG + Intergenic
1068064776 10:52115761-52115783 CTGGGTATACAGAAGGGTAAAGG - Intronic
1068323555 10:55452937-55452959 CTTGGAATACAGAACAGTAAAGG + Intronic
1070437275 10:76405484-76405506 CTGTTTATACAACAGGGTAAAGG + Intronic
1073299000 10:102459359-102459381 CTGGGTATCCAGTGGGGAAATGG - Intergenic
1077704333 11:4469748-4469770 CTGAGTTTACAGAAGGGAATAGG + Intergenic
1078199870 11:9171189-9171211 CAGGGCATTCAGCAGGGTAATGG + Intronic
1078395566 11:10978786-10978808 CTGGGTATACTTGAGGGTAGAGG + Intergenic
1078493800 11:11796048-11796070 CTTGGAGTACAGAAGGGAAATGG - Intergenic
1078563603 11:12394723-12394745 CTGGGTATACACAGGGGTCCTGG - Intronic
1079100603 11:17539271-17539293 GTGGGGAGACAGGAGGGTAAAGG - Intronic
1080027098 11:27626444-27626466 CTGGATATGCAGAAGCGTGAGGG - Intergenic
1081302403 11:41468288-41468310 CTGGGTATTTATAAGGGAAAGGG - Intergenic
1081340489 11:41921519-41921541 CTGGGTCTCCAGAAAGGGAAAGG - Intergenic
1087853447 11:103060536-103060558 TTGGGTATACACAAGGGTCCTGG + Intergenic
1088071177 11:105787171-105787193 CTGTGTATAAAGAAGTCTAAAGG + Intronic
1091780384 12:3210207-3210229 CTGGGTATATAGGAGTGTAATGG + Intronic
1093892851 12:24544489-24544511 CCAGATATACAGAAGGGTAATGG + Intergenic
1094076865 12:26486259-26486281 TTGTGTATACAGAAGAGAAATGG - Exonic
1094754728 12:33454780-33454802 CTTGGTATACAGAACGGCCAAGG - Intergenic
1096947694 12:55426387-55426409 GTGGGAATCCAGCAGGGTAAGGG - Exonic
1099863601 12:88250145-88250167 CAGGCTATACCGAAGAGTAATGG + Intergenic
1101390855 12:104298967-104298989 TTGGGTATACACAAGGGTCCTGG - Intronic
1101699011 12:107154143-107154165 CTGGGTATCTAGAGGGGAAAGGG - Intergenic
1101792246 12:107938355-107938377 CTGGGTAGAGAGAACAGTAAGGG + Intergenic
1102626192 12:114237199-114237221 CTTTGTATTCAGCAGGGTAATGG + Intergenic
1103081402 12:118026866-118026888 CTGTGTAGACAGAGGGGGAAAGG - Intronic
1105584769 13:21733815-21733837 TGGGGTATACAGGAGGGTAGGGG + Intergenic
1107892602 13:44927399-44927421 CTGTGTACACAGATGGGCAATGG - Intergenic
1111734044 13:92114830-92114852 TTGAGTAGACAGCAGGGTAATGG + Intronic
1112605394 13:100899863-100899885 CTGGGCAGACAGAAGTGTGAAGG + Intergenic
1115084926 14:29503245-29503267 TTTGGTATGCAGATGGGTAAGGG - Intergenic
1116932111 14:50701414-50701436 CTGGTGATACATAATGGTAAAGG - Intergenic
1118166818 14:63344819-63344841 CAGGGAATAAAGCAGGGTAAGGG - Intergenic
1120165627 14:81195789-81195811 CGGGGTATTCACAAGGGTCAGGG - Intronic
1121686255 14:95837472-95837494 CTGGGAATACACTAGGGTGAGGG - Intergenic
1123902548 15:24891177-24891199 CTGGGAATACAGTTGTGTAATGG + Intronic
1126950452 15:53874626-53874648 TTGGATATACAGGATGGTAAAGG - Intergenic
1131288709 15:91085733-91085755 CTTTGTATACAGTAAGGTAAGGG + Intergenic
1131821138 15:96275064-96275086 CTGGGTAGAAAGAAGTTTAAAGG - Intergenic
1132037571 15:98499502-98499524 CTGGGAAAAGAGAAGGGAAAAGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132136456 15:99345243-99345265 CTGGGTATATGCAATGGTAAGGG - Intronic
1133184892 16:4088975-4088997 CTGGGGAAACTGAAGGGAAATGG - Intronic
1134262443 16:12662889-12662911 ATGGGTTTGCAGAAGGATAATGG - Exonic
1135029915 16:19030105-19030127 CTGGGGATACAGAGAGGAAAGGG + Intronic
1137398063 16:48131140-48131162 CTGTTGATACAGAAGGGAAAAGG + Intronic
1138058425 16:53861319-53861341 CACTGTATACAGTAGGGTAAAGG - Intronic
1138802643 16:60052700-60052722 CTGGGAATACAGTAGTGTAGAGG + Intergenic
1139728265 16:68920115-68920137 CTGGGAATACAGCAGGGGACAGG + Intronic
1142779645 17:2171437-2171459 CTGGGTAGAAAGAAGGATTACGG + Intronic
1146482187 17:33213705-33213727 CTGGGTGGAAAGAAGGGGAAAGG - Intronic
1147580627 17:41625430-41625452 CTTGGGGTACAGAAGGGTGAGGG - Intergenic
1152212673 17:79010660-79010682 CAGGGAATACAGAACGGCAATGG - Intergenic
1154283877 18:13033714-13033736 GTGGCTATACAGAATGGTAAAGG + Intronic
1157032227 18:43925445-43925467 GTGGATATGCATAAGGGTAAGGG + Intergenic
1158579198 18:58666928-58666950 CTGGGGATACTGATGGGAAAGGG - Intergenic
1158935555 18:62361345-62361367 CTGGGGATACTGAAGGGTTCTGG + Intronic
1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG + Intergenic
1166712145 19:44944596-44944618 CAGGGGACACATAAGGGTAAAGG + Intronic
1167152337 19:47717437-47717459 CTGGGTAGAGAGAAGGGAATTGG - Intronic
1168721746 19:58558266-58558288 CTGCGGATCCAGAAGGGTAGGGG - Exonic
925509320 2:4607351-4607373 CTAGGTATAGAGAAGAGTAATGG - Intergenic
927937746 2:27085085-27085107 CTGGGGATCCAGCAGGGGAAGGG + Intronic
929280623 2:40073981-40074003 CTGTATATACAGAAAGGTAAGGG + Intergenic
930174317 2:48286179-48286201 GTGAGGATAGAGAAGGGTAATGG - Intergenic
934794691 2:97090594-97090616 CGGGGTAACCAGAAGGGGAAAGG - Intronic
935081085 2:99795373-99795395 CTGGGGACTCAGAAGGGCAATGG + Intronic
938374856 2:130798458-130798480 CTGGGTACACAGCAGGACAATGG + Intergenic
941603669 2:167568331-167568353 CTGGGAATGCAGAATGGTATAGG - Intergenic
942670919 2:178375883-178375905 CTGGGTATACAGAAATGAAGAGG + Intronic
943085940 2:183311179-183311201 CTGAGTATACAGAACCCTAAGGG - Intergenic
944956493 2:204817454-204817476 CAGAGTACACAGAAGGGTATTGG - Intronic
947175726 2:227365353-227365375 CAGGCTATACAGAGAGGTAATGG + Intronic
947267379 2:228298681-228298703 CTGGGGATACAGAAGTTGAAAGG - Intergenic
947881609 2:233519104-233519126 CTTGGAATACAGATGGGTACAGG + Intronic
1171518687 20:25759445-25759467 GTGGGCCCACAGAAGGGTAAGGG - Intergenic
1173016610 20:39231599-39231621 CTGAGTCCACAGAAGGGAAAAGG - Intergenic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1174295746 20:49543847-49543869 CTGGGGATACAGCAGGGAACAGG - Intronic
1174669779 20:52296156-52296178 CTGGCTACACAGGAGAGTAAGGG - Intergenic
1177322990 21:19546093-19546115 CTGGGTTTACAGAAAGATTAAGG + Intergenic
1177476683 21:21632948-21632970 CCGGATATATAGAAGGGTAGAGG + Intergenic
1179808398 21:43854612-43854634 CTGGGTGCACAGAAGGGCCAAGG + Intergenic
949861357 3:8508084-8508106 CTGGTTTTCCAGAAGGCTAATGG + Intronic
950578706 3:13849074-13849096 CTGGGGATTCGGAAGGGGAAGGG + Intronic
952162483 3:30707766-30707788 CTGGATATCTAGAAGGATAATGG + Intergenic
953186359 3:40641827-40641849 CTGGGTGTACCGAAAAGTAAGGG + Intergenic
957578056 3:82034482-82034504 CAGAGTATAAAGCAGGGTAAGGG + Intergenic
959394230 3:105816464-105816486 CTGGGTATACCTAAGGTTACAGG + Intronic
961140006 3:124547766-124547788 TTTGGTATACATAGGGGTAAGGG - Intronic
962390300 3:134966069-134966091 CTGGGTACACAGAGGGGCAAGGG + Intronic
963608314 3:147433471-147433493 CTGAGTAAAGAGAAAGGTAAAGG + Intronic
967544177 3:190703923-190703945 CTGGGTCTCTAGAAGGTTAAGGG + Intergenic
967758805 3:193200919-193200941 AAGGGTATACATAATGGTAAAGG - Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
970107797 4:12604608-12604630 CTGGGAATGCAGAAGAGTTATGG - Intergenic
973304580 4:48631147-48631169 CTTGGTATATAGGAGTGTAAGGG + Intronic
975732010 4:77346641-77346663 CTGGGCATAGAGCAGGGCAAAGG + Intronic
980955358 4:139422705-139422727 CTGGGAATACAGAAGTGAACAGG - Intergenic
982078443 4:151762342-151762364 CTGAGTATAGAGCAGGGCAAGGG + Intergenic
982131242 4:152230533-152230555 CTGGGAATCCAGAAGGGCTATGG + Intergenic
982437881 4:155399076-155399098 CTAGGTGTACGGAGGGGTAAGGG + Intergenic
983184407 4:164684984-164685006 CAGGGTACAGAGATGGGTAAGGG + Intergenic
983234847 4:165167596-165167618 ATGGGTACACATATGGGTAAGGG - Intronic
983804367 4:171975616-171975638 CTGGGTGGACAAAAGGGCAAGGG + Intronic
985344221 4:188985796-188985818 CTGAGTTTACAGGAAGGTAAGGG - Intergenic
992754665 5:79893106-79893128 CTGGGTACGGGGAAGGGTAAAGG - Intergenic
996522708 5:124445080-124445102 TGGGGTATACAAAAGTGTAATGG - Intergenic
996714120 5:126572868-126572890 CTGTGTATTCAGAAGGATATAGG - Intronic
996993332 5:129663909-129663931 CTGTGTATAAGGAAGAGTAAGGG - Intronic
998159409 5:139804701-139804723 CTGGGTATGCAGAAGGGACTGGG - Intronic
999505950 5:152196445-152196467 ATGGGTGAACAGAAGGGAAAGGG + Intergenic
999610632 5:153365370-153365392 CTGGGTATACAGAAATGTCAGGG + Intergenic
1002328739 5:178427317-178427339 GTGGGAATGCAGAAGGGTACAGG + Intronic
1002850927 6:995735-995757 CTGGGCATACAGAGGCGTACAGG + Intergenic
1005326032 6:24701746-24701768 CTGGATATCAAGTAGGGTAAAGG + Exonic
1007459672 6:42009048-42009070 TAAGGTATACAGAAGTGTAAGGG + Intronic
1007838847 6:44699028-44699050 CTGGGTTTACAGAATGGACAAGG - Intergenic
1008186232 6:48394492-48394514 CTGGGTATATTGAAGGGTGGAGG - Intergenic
1011162701 6:84409804-84409826 TTGGCTATAAAGAAGGGTAGGGG - Intergenic
1014732473 6:125049737-125049759 CTGGGTATTGAGAAGGGCATGGG + Intronic
1014747227 6:125214240-125214262 CTGGGCACAGAGAAGGGTAGAGG + Intronic
1015305351 6:131700890-131700912 TGGGGCCTACAGAAGGGTAAAGG + Exonic
1015918335 6:138241290-138241312 CTGGGTAGACAGAGGAGTGATGG - Intronic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1018310552 6:162503817-162503839 GTGGGTAAACAGGAGGGTGATGG + Intronic
1018764428 6:166921961-166921983 CTGCGTATTCAGGGGGGTAAAGG - Intronic
1019635368 7:2072752-2072774 CTGGCCAGAGAGAAGGGTAAGGG + Intronic
1019798794 7:3072587-3072609 CTTGTTCTACAGAAGGGAAAAGG - Intergenic
1023238374 7:38115093-38115115 CTGGGTATACAGAAGGGATTAGG - Intergenic
1030794787 7:113774404-113774426 CTGGAAATACAGAAGTGTTATGG - Intergenic
1033739461 7:144259117-144259139 TGGGGCCTACAGAAGGGTAAAGG + Exonic
1034094373 7:148392881-148392903 CTGGGTATACTCAAGTCTAATGG - Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1036496505 8:9274806-9274828 ATGGATAGACAGAAGGTTAAAGG + Intergenic
1036966224 8:13301097-13301119 CTGTGGATACAGGAGGATAATGG + Intronic
1039704238 8:39990677-39990699 GTGGGTATTCAGAAAGATAAAGG - Intronic
1046252283 8:111647973-111647995 CTAGGTAAGCAGCAGGGTAAAGG + Intergenic
1051552538 9:18346091-18346113 CTGAGGAAACAGAAGGCTAATGG - Intergenic
1054836822 9:69684183-69684205 CAGAGTATACAGAAGCCTAAGGG - Intergenic
1061752194 9:132786818-132786840 CTGGTTATGCAGAAAGGAAAAGG + Intronic
1187094360 X:16130639-16130661 CTGGGCCTCCAGAATGGTAAAGG - Intronic
1190871635 X:54429743-54429765 CTGGTTATACAGATGGGAGAAGG - Intergenic
1191996390 X:67100211-67100233 CTGGGTAAATATAAGGGTGAGGG + Intergenic
1192991220 X:76459452-76459474 TTGTGTATACTGAAAGGTAAGGG - Intergenic
1193692477 X:84663488-84663510 GTGGATATTCAGAAGGGTGATGG + Intergenic
1193826511 X:86233176-86233198 CTGGGTCTATAGGAGGGTGAAGG + Intronic
1195492860 X:105493261-105493283 CTAGGTATACACAAGAGAAATGG - Intronic
1196527344 X:116741524-116741546 CTGGGTATAGAGAGGGACAACGG - Intergenic
1199408893 X:147496263-147496285 CTGTGTATCAAGAAGAGTAATGG - Intergenic