ID: 1068071981

View in Genome Browser
Species Human (GRCh38)
Location 10:52207086-52207108
Sequence GACTGCACATCATTGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068071976_1068071981 -1 Left 1068071976 10:52207064-52207086 CCCCAGTAGTGGCAGTGTGGCAG 0: 1
1: 0
2: 1
3: 20
4: 234
Right 1068071981 10:52207086-52207108 GACTGCACATCATTGGGAGCAGG No data
1068071978_1068071981 -3 Left 1068071978 10:52207066-52207088 CCAGTAGTGGCAGTGTGGCAGAC 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1068071981 10:52207086-52207108 GACTGCACATCATTGGGAGCAGG No data
1068071977_1068071981 -2 Left 1068071977 10:52207065-52207087 CCCAGTAGTGGCAGTGTGGCAGA 0: 1
1: 0
2: 2
3: 13
4: 392
Right 1068071981 10:52207086-52207108 GACTGCACATCATTGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068071981 Original CRISPR GACTGCACATCATTGGGAGC AGG Intronic
No off target data available for this crispr