ID: 1068082248

View in Genome Browser
Species Human (GRCh38)
Location 10:52333528-52333550
Sequence CTGTAGACACAAATATAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068082248_1068082250 6 Left 1068082248 10:52333528-52333550 CCTTGCTATATTTGTGTCTACAG No data
Right 1068082250 10:52333557-52333579 ATTTTACCAATAATTCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068082248 Original CRISPR CTGTAGACACAAATATAGCA AGG (reversed) Intergenic
No off target data available for this crispr