ID: 1068082250

View in Genome Browser
Species Human (GRCh38)
Location 10:52333557-52333579
Sequence ATTTTACCAATAATTCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068082247_1068082250 7 Left 1068082247 10:52333527-52333549 CCCTTGCTATATTTGTGTCTACA No data
Right 1068082250 10:52333557-52333579 ATTTTACCAATAATTCCTGTAGG No data
1068082248_1068082250 6 Left 1068082248 10:52333528-52333550 CCTTGCTATATTTGTGTCTACAG No data
Right 1068082250 10:52333557-52333579 ATTTTACCAATAATTCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068082250 Original CRISPR ATTTTACCAATAATTCCTGT AGG Intergenic
No off target data available for this crispr