ID: 1068092805

View in Genome Browser
Species Human (GRCh38)
Location 10:52453957-52453979
Sequence CTTGTTCTGTGCACTGTGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068092805_1068092807 4 Left 1068092805 10:52453957-52453979 CCCGACACAGTGCACAGAACAAG No data
Right 1068092807 10:52453984-52454006 TCTAGATCCTTGTTTTTATGTGG No data
1068092805_1068092808 5 Left 1068092805 10:52453957-52453979 CCCGACACAGTGCACAGAACAAG No data
Right 1068092808 10:52453985-52454007 CTAGATCCTTGTTTTTATGTGGG No data
1068092805_1068092809 9 Left 1068092805 10:52453957-52453979 CCCGACACAGTGCACAGAACAAG No data
Right 1068092809 10:52453989-52454011 ATCCTTGTTTTTATGTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068092805 Original CRISPR CTTGTTCTGTGCACTGTGTC GGG (reversed) Intergenic
No off target data available for this crispr