ID: 1068094475

View in Genome Browser
Species Human (GRCh38)
Location 10:52473116-52473138
Sequence CCTCACATGGTTGAGCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068094467_1068094475 22 Left 1068094467 10:52473071-52473093 CCCTTTAAGAGCTGGTTAAATAC No data
Right 1068094475 10:52473116-52473138 CCTCACATGGTTGAGCAGTGGGG No data
1068094468_1068094475 21 Left 1068094468 10:52473072-52473094 CCTTTAAGAGCTGGTTAAATACA No data
Right 1068094475 10:52473116-52473138 CCTCACATGGTTGAGCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068094475 Original CRISPR CCTCACATGGTTGAGCAGTG GGG Intergenic
No off target data available for this crispr