ID: 1068094475 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:52473116-52473138 |
Sequence | CCTCACATGGTTGAGCAGTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1068094467_1068094475 | 22 | Left | 1068094467 | 10:52473071-52473093 | CCCTTTAAGAGCTGGTTAAATAC | No data | ||
Right | 1068094475 | 10:52473116-52473138 | CCTCACATGGTTGAGCAGTGGGG | No data | ||||
1068094468_1068094475 | 21 | Left | 1068094468 | 10:52473072-52473094 | CCTTTAAGAGCTGGTTAAATACA | No data | ||
Right | 1068094475 | 10:52473116-52473138 | CCTCACATGGTTGAGCAGTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1068094475 | Original CRISPR | CCTCACATGGTTGAGCAGTG GGG | Intergenic | ||
No off target data available for this crispr |