ID: 1068096630

View in Genome Browser
Species Human (GRCh38)
Location 10:52499457-52499479
Sequence GCGGCTGCTGGGAGGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068096619_1068096630 0 Left 1068096619 10:52499434-52499456 CCTCTCCTTGGGCAGGTCTTGCC No data
Right 1068096630 10:52499457-52499479 GCGGCTGCTGGGAGGGATGGGGG No data
1068096621_1068096630 -5 Left 1068096621 10:52499439-52499461 CCTTGGGCAGGTCTTGCCGCGGC No data
Right 1068096630 10:52499457-52499479 GCGGCTGCTGGGAGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068096630 Original CRISPR GCGGCTGCTGGGAGGGATGG GGG Intergenic
No off target data available for this crispr