ID: 1068100545

View in Genome Browser
Species Human (GRCh38)
Location 10:52547207-52547229
Sequence CCATGGGTATGGAGGGCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068100545_1068100551 -8 Left 1068100545 10:52547207-52547229 CCGTCAGCCCTCCATACCCATGG No data
Right 1068100551 10:52547222-52547244 ACCCATGGGTCTTGCACCTGTGG No data
1068100545_1068100555 13 Left 1068100545 10:52547207-52547229 CCGTCAGCCCTCCATACCCATGG No data
Right 1068100555 10:52547243-52547265 GGATTCAACCAACCACAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068100545 Original CRISPR CCATGGGTATGGAGGGCTGA CGG (reversed) Intergenic
No off target data available for this crispr