ID: 1068100555

View in Genome Browser
Species Human (GRCh38)
Location 10:52547243-52547265
Sequence GGATTCAACCAACCACAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068100552_1068100555 -3 Left 1068100552 10:52547223-52547245 CCCATGGGTCTTGCACCTGTGGA No data
Right 1068100555 10:52547243-52547265 GGATTCAACCAACCACAGATAGG No data
1068100549_1068100555 5 Left 1068100549 10:52547215-52547237 CCTCCATACCCATGGGTCTTGCA No data
Right 1068100555 10:52547243-52547265 GGATTCAACCAACCACAGATAGG No data
1068100550_1068100555 2 Left 1068100550 10:52547218-52547240 CCATACCCATGGGTCTTGCACCT No data
Right 1068100555 10:52547243-52547265 GGATTCAACCAACCACAGATAGG No data
1068100548_1068100555 6 Left 1068100548 10:52547214-52547236 CCCTCCATACCCATGGGTCTTGC No data
Right 1068100555 10:52547243-52547265 GGATTCAACCAACCACAGATAGG No data
1068100545_1068100555 13 Left 1068100545 10:52547207-52547229 CCGTCAGCCCTCCATACCCATGG No data
Right 1068100555 10:52547243-52547265 GGATTCAACCAACCACAGATAGG No data
1068100553_1068100555 -4 Left 1068100553 10:52547224-52547246 CCATGGGTCTTGCACCTGTGGAT No data
Right 1068100555 10:52547243-52547265 GGATTCAACCAACCACAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068100555 Original CRISPR GGATTCAACCAACCACAGAT AGG Intergenic
No off target data available for this crispr