ID: 1068102932

View in Genome Browser
Species Human (GRCh38)
Location 10:52579465-52579487
Sequence ATTTTTCATTTAAGATCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068102932_1068102933 -5 Left 1068102932 10:52579465-52579487 CCTGTAGATCTTAAATGAAAAAT No data
Right 1068102933 10:52579483-52579505 AAAATACAGATCTGCAGAAGAGG No data
1068102932_1068102934 -4 Left 1068102932 10:52579465-52579487 CCTGTAGATCTTAAATGAAAAAT No data
Right 1068102934 10:52579484-52579506 AAATACAGATCTGCAGAAGAGGG No data
1068102932_1068102935 0 Left 1068102932 10:52579465-52579487 CCTGTAGATCTTAAATGAAAAAT No data
Right 1068102935 10:52579488-52579510 ACAGATCTGCAGAAGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068102932 Original CRISPR ATTTTTCATTTAAGATCTAC AGG (reversed) Intergenic
No off target data available for this crispr