ID: 1068102935

View in Genome Browser
Species Human (GRCh38)
Location 10:52579488-52579510
Sequence ACAGATCTGCAGAAGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068102932_1068102935 0 Left 1068102932 10:52579465-52579487 CCTGTAGATCTTAAATGAAAAAT No data
Right 1068102935 10:52579488-52579510 ACAGATCTGCAGAAGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068102935 Original CRISPR ACAGATCTGCAGAAGAGGGC TGG Intergenic
No off target data available for this crispr