ID: 1068103316

View in Genome Browser
Species Human (GRCh38)
Location 10:52582640-52582662
Sequence TCTTACATGGAGACAGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068103306_1068103316 26 Left 1068103306 10:52582591-52582613 CCATGTAGCCAGGGAGGCGTTAC No data
Right 1068103316 10:52582640-52582662 TCTTACATGGAGACAGGGCAGGG No data
1068103307_1068103316 18 Left 1068103307 10:52582599-52582621 CCAGGGAGGCGTTACAATCGTGG No data
Right 1068103316 10:52582640-52582662 TCTTACATGGAGACAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068103316 Original CRISPR TCTTACATGGAGACAGGGCA GGG Intergenic
No off target data available for this crispr