ID: 1068104478

View in Genome Browser
Species Human (GRCh38)
Location 10:52596845-52596867
Sequence ACAGAAATGTTGGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068104473_1068104478 29 Left 1068104473 10:52596793-52596815 CCGAGGCAGCCAAATATTTATAA No data
Right 1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG No data
1068104475_1068104478 20 Left 1068104475 10:52596802-52596824 CCAAATATTTATAAAAGAGGATA No data
Right 1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG No data
1068104472_1068104478 30 Left 1068104472 10:52596792-52596814 CCCGAGGCAGCCAAATATTTATA No data
Right 1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068104478 Original CRISPR ACAGAAATGTTGGCCAGGTG CGG Intergenic
No off target data available for this crispr